Caenorhabditis_elegans Locus rpl-15
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rpl-15
Caenorhabditis_elegans
rpl-15
IV
K11H12.13, K11H12.12
1222..1354, 1553..1681
3145
TCCCTGAACTCTTTAAATCGTTTTCTCGTCAAAAATTATTGAAAAACTCACTTGATTTA
CTCGAGAACCGAATCCGGACTGCCCTCCTCCATAACGAGCTGATTTTGCGGCGGTGTTGG
CGAAAAATCGGACTCCCGAGGTGAAAGTCGCCACTTTTGGAACGGTCATCGTGAGACGAG
ACAACATTTTCTGACTGAAATGATGAGAATACGACGAGAAAAGTGGAAATTGTGTTTGTT
TGTGATGAAAACAACCGAGGTCACGTGGGAAAAAATGATGCAACGAGGAGTTATGAAATT
TAGAAAGTTCTAGATGTTTTAGAATGTCTAGCGAAAATAACGTAGCCTAAAATAAGGGAT
AAACCATTTATTATAGCTTTATGCCGGATTTCCAAAGTTCTACAAATAAAAACCACATTT
TAGGGAGAAAAATGACTTTTTTATTCGATAGAAACCGAATATTACTGATTTTATAGATAT
TTTTCGATTAAATATAATGTTTTATCAATTAAAAATACGAAAAAACCAGATAAAAACCTG
AAAAAACCTGTAAAACAAGGAAAAACATATTAAAAATCACAAACAATTCGTGTCGATTTA
CGGCGGACGAGGCTTGGCACACGGCCAGCCGCCGGACTACGGTGTTTGCATTGTGGAGCG
TGTTTCGAGTGTATGCGAAGTGTATGAGAGCGTCTTCTCATTTCACACACGAGTTTTGTT
GGCCTAAACGATTTTTTTGGATTTTTCAGCAATTTTAGTGAAGTTTTCCTAGGTTTTTCA
TGAATTTTGTTAAATTAATTTAAAATTTTAATTTTTACTGGCAAAAAATCAGTAGTTTGT
TATTTTTACGCAGAATTCCGCCCAAAATGTTGGGACTTTGATGAAATAGATTTTCTGTCA
GCCAGAATTTTAAAAAACTATGTTCCATTCTTCGATTCACTTTTCTTTTTCAACAATTTT
ATTTATTCAACCCCTCAATCTCGTTATTCTAACCTTTTTTCTTTCAGAAAACATGGGTGC
ATACAAGTATATGCAGGAAATCTGGCGCAAGAAGCAGTCAGATGCTCTTCGCTACTTGCT
CCGTATTCGTACCTGGCACTACAGACAGTTGAGCGCCGTCCACCGTGTCCCACGCCCAAC
CAGACCAGAGAAGGCTCGCCGTCTCGGATACCGTGCCAAGCAAGGTAAGATTGTAAAGAT
TTGAATAAAATTTTAAAAGCTACTTGCCACAATGTCTGGGCAAGGTGCCCTGCACCCGCT
TGAGCAACCTAATCCATTGATGGCTATATAAAATTCATTGAGTAATCCCTGTTGAGTTAT
ATAGAACTTTCCAGTTTCATATCATTGATACAATTTATTGAGATTAAATTTCATTTTTCA
GGATTCGTTGTCTACCGCGTCCGTGTCCGCAGAGGAAACAGAAAGCGTCCAGTCTGCAAG
GGACAAACCTACGGAAAGCCAAAGACCCATGGAGTTAACGAGCTCAAGAACGCCAAGTCT
AAGCAAGCCGTTGCTGAGGTGATTACTACGAATTAAATGATTAGATGAAATTGTTGCCTC
AGTGTCTGGGCAAAGCAGACTGTTTTTAATAGTACTGACTTAATCCACTGATGGCTATAG
AAAAACATTGTGTAATCCCCGAACACCTTGTGGTGTATTGGATTCATGACATTGTGACAA
TTTAAACAAAATTTTCAGATATTAGCATTTACTTTTCAAAGTTAATTCGTTGTATTTCAG
GGCCGCGCTGGACGTCGTCTTGGATCCCTCCGTGTTCTCAACTCCTACTGGGTTGCTGAG
GACTCCACCTACAAGTTCTACGAGGTTGTCCTGATCGATCCATTCCACAAGGCTATCCGT
CGTAACCCAGACACCCAATGGATCACCAAGCCAGTTCACAAGCACCGTGAGCAAAGAGGA
CTCACCTCTGCTGGACGCAAGTCTCGTGGACTCGGAAAGGGATGGCGTTTCTCTGCTACC
CGCGGAGGATCCCAAGCCAAGAACTGGAAGAGAAAGAACACCAAAGTTTTCCACCGCAAG
CGATAAATCTTGTTATTTTATTTTGTTTTGGGCTTGTTCCGAAAATGAAATGGTTGTTAT
CAAACCTAATTGTTTTATCTTTGTATTTTTCACATTAAAAAAGAAATAGTTTTTAAAATC
ACAGTCTTCATGAAAAGAGTAATGAGCACATTGAGCGAAGGCCCAGTAGCACGTCTTCTC
AAGGAGAAGCTGTTCGCCGCGTTCCAGGTAAACTGATCTCTAAATATGTCGGAAGGAAAC
TGTTGAATTCTAGCCAAAACATCTCGAAGTGGAATGCGAGAGCCACCTGCACAACGTTCC
AAAAGGAGCCGAGAAGCACTTCCGAGTGCAAGTTGTCAGTGATGAGTTCGAGGGGAAACG
TGTCATCGAGGTTGGTGGAAAAAGATCGATACATGGATTAGTCGAACACATGGAAAAACT
CGCTAAAGGCCGTGGAACGGCACTTTTTCATAGGCTTTACCAATTTTTCAGCTAAAACAT
TTGCTTTTTCAACATTATCGCCAATTTATTCCTTCTTAAAAACATGGATTTGTCGATTTC
GTGGCTAAAAGTATGATATCTGGTCTCGACACGACAAGTTTTGTTAAATACAAACGGGTG
TGCGCCTTTAAAGAGTACTGTAATTTCAAGGACTCGTTTCTGCGCAATTTTCATCGACTT
TTCATAATTTTTCGATAAAAATTATTTATTTATTTAAAAAAACCCATAACAATAAAAACA
CATAAATTCGCGAGAAAAACTATGAAAAATCGATAAAAACTCGGTAGAAATAAAATTTTG
AAGTTACTGTATTTTTTTAAAGACGCACTCTTTTTCCAATGTAACAGAAAATTTAGTTTC
GAGGCCGCCGGATGATACCGCATTTTTGGAGCAAAAATCGCAAATTTTCGCTAAAATTGG
CGAAAATAGTTCAAAAATTTGGAAGTTTCGTGTTTGCGGCCCCAATACCTAACGAGACCC
AAATTATGGTTATTATAAGAACAAAAAATTCTGTTGACGTGCAAAATATCTCGTAGCGAA
AACTACAGTAATTGTTTAAATGACCCCACTGTAGCTCTTGTGTCGATTTACGGGCACAAT
TTTTGAAACGAATTTCTATGGTTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1183, 1381..1517, 1740..2145
1012..1183, 1381..1517, 1740..2042
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved