Caenorhabditis_elegans Locus cyk-4
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans cyk-4
Caenorhabditis_elegans
cyk-4
III
K08E3.11
2290..2366
4701
CACAGCACTCGGTCATTTGCCAATTTCCGCGTACGTGAGTTAGAGCTGCGGCCGGATCG
TTGCAGGCTAGACATTTGAACTTGAATTCAGCGAAAAGACCTGGAGTACAGCATTCTTCG
CAGACCGCCGGTATTCTCTTGCTTTTGAGAACGTCGGACCAGTTCTGGGGTTCAGATTTG
ACTAGAACAGAGGTTGACGAGCATTTTTGGCAATAAACCCGCAGTTTGCCGCGCTTGACG
TCGTCACAATTTTTGCACCACACGTAGAAGCTTCCGAGAATTGAAGAATCTGTTGTTATT
TTTGCAGTAGTAGCACCGTTTTCGTTGTGACTATTGAACTTTGGACGGAGAAGCATGATT
TGTCTGAAATAATATTATTTGAATAACAATTCCAGTTATTTATATAAATAACAATTCCAG
TTATTTATATAAGTAAATATTTACTTGACCTACGTTGCAGGTGTCAGTGACAAATCCCTC
ATAATCGTTGATTTTGATAACTTTTTCCCACAGAAAACCACTTCCAGCTCATCGCTGGGA
ATTTCGGTGAGCTTTTCCACATCTTTTGTGAGATCTTCGATATTTCCAGTTATATTTATC
TGAAAAAAATAATGTATATATTCAAAGTTTGAAATGTCCACTACATTAAGTGTTAGATTC
CTACGTTGACCTGTTTTTCTATCTTGTATTAATATAGAGATTTCATCAGACATGCTTCAT
GAGAGCTGAAAATTTGACTTAGAAATTAACAAAAAAATTTCCTGCTAGCGGGCCTGCTTG
CAGTTTTAAACATTAAATTCAAAAAACTAGTCGAGGCCTTGAAGCCCCATGTTTTTGTGC
ACACTAGTCCTCGCAGTCATGTGCGCCCTATGGCAAGCGTAGCGGGTCGCGTCGCGTGTG
AGACAAACGCAGCGAGCTTCAAATTCGAACTGTTTTCCACGAAATTTGAAACGGTTTTCA
CGCATTTTTCTCTTATTTTCGGGCGAGTTTCTCGTTTTCTAATCATTTCCACATTTTAGA
ATGAAGTCCAGTACATCAAAAGAGAAGGTGTGCGGCGAAAACTCGCGTCACATTTTCAAC
ATGATTCTAAACTCACAGCGACCGCAATTCGATATTAAGGATATAGGTTAGTTTCAATTA
TCATTTTCAAATTTTAATGACGTGTTTCAGGAATGTTTCATTTGATTGATGAGATTGAGC
GTCTCCGCAAGCTGTGGAAAGATTCCGAGGAATCCAAAAAGCGGCTGAATGCAGATATGA
GAGAGGCCGAAGAAGCACTTGCGTAAGTGAAATATTTCATGTTTACGTGTTTAGAAAACA
CTATTATTTCAGAAAAGCTCGCAAGAAGCTGGCAATGTTCGATATCGATGTCAAAGACAC
TCAGAAACATTTACGCGCGTTGATGGAAGAAAATAAGGCGTTGAAGCTCGATCTAAACGT
CTACGAGACTCGTGAAAAGCAGCTGAAAGATGCGATGAAGAACGGTATATTCAATAGTCT
CACCAAGGAAGACCGCGATCAGTTCAAGTTTCTTCACGAGCCACTGGTCCGGACATACTC
GAAACGGGTGCAGCAGAGGCATCCACATTTGATGGAGGACACACAGGACGATGAGGACGA
TAGTGAGGTGGATTACGATGAAACTGGAGACAGTTTCGAGGAAGTTATTCATTTGCGCAA
TGGAAGAGAGGTCAGAAGAAGCTCAGCTGCTGGAAACGCAGTTGGTGGCAAGCGGAGAAG
CGCGTCAGCACATGCGATTACTGCTGCTGCCAATTCGAAGAGGAGCAGAAGCCGTGTTAT
GACAGCTACTATAGATGAAGAGCCGGTAAAAATTATGACATGACAGTTTTTGTTGAATTG
CGTTTGTTCTTTCAGAATGAGGGTGGTACACCTCCAAAAAGATGCCGTGATGATGGTTCT
ACACCTCATCAAGAAATGACAACTACCACCACTACCACCACCACCACTACTATTCATAAC
TCTCGAGCTCAGAACCAGGACCCGCCACGTGTCTCACTTCACCGCCAGCTCACCCGCAGG
AGCTTGAGCTGTGGAAGTATTCCATCATGCGATCAAACACCAGGACAAACCACAAATAAC
ATCGGCCTCGGCATGTCGTCCGCCATTCTCACCAAAAGCACACTTGATATCCGAACCCTG
AAACGTGGCACGCCGGCGTGGACTAATGGAACAACTCGTGACATCGCAATGAGACCACAC
ACGTTTATAGAGGCAGGAATCAAAGCGGTACGTGTAAAAAATGCTAACAAATTTCTTTAA
AGTGAGCTCTGTAGTGATGAAAATCATGCTAATCATGAAGAGGCGCGTCCGTCTCGGACC
CCATGTTGCAAACATCTATTTCTGAACAAAGAATTCCTATTTTTTCTGTTAAACATGAAT
TGCCACACTGTTTTAATACCTTTTTGATTTTCAGATGCGAAAATGCGACAAATGTGCTAC
AGCCCTGAAGCTCGCCACATCAATGAAATGCAGAGACTGTCACCAGGTTGTCCATCGTAG
TTGCTGCAACAAACTTCATCTCCCGTGCATACCACGCCCCAAGACGATGATGACGCCGAA
ATCCGCATTACGTGGAGCCAAGCCGGGCGCAGGAGAGTTCCGACTTCAAGATTTTTGCAC
ATCTGCGAAGCCAATGATCCCGGCAGCAGTTATTCATTGTGTGGTTGCCCTGGAGGCTCG
TGGACTCACGCAGGAAGGTATTTACCGCGTTCCTGGGCAGGTTAGAACTGTCAATGTGCT
TTTGGACGAGTTGAGATCAAAAACGGTACCCAACGTGGGCCTTCACGACGTTGAGGTCAT
CACAGACACCTTGAAACGGTTCCTAAGAGATCTTAAAGACCCGTTGATCCCAAGAACGTC
TCGTCAAGAGCTCATCGTTGCTGCAAACCTCTACTCTACGGATCCAGATAATGGACGTCT
CGCCCTGAATCGAGTGATCTGTGAGCTCCCCCAAGCGAATCGAGACACCCTCGCCTACCT
TTTCATTCACTGGCGCAAAGTTATCGCACAATCGAGTCGCAACAAGATGAACTGCGAAGC
GATGGCGCGGATGGTGGCTCCGGCGGTGATGGGTCATCCAGTGAAGCAATCGCAGTCCCA
AGCGATAGCTGGCAGAGATGCCACGGATTGCCATCGAGCGATGACTGCTCTATTTGAATT
TGATGATGTAAGTTTTCAGGAGGATATTTTCAAGATTAAAATAAAAATTGCAGGTATATT
GGCAACGATTCCTAGGGACATCTGCAGTTTCCATGGCTTCTAATCAAATTGAAACGGCTC
GACATCAGGACAATTTTGCTCTCTGTGATCGTAGCATCCTTGGACCAGTTACAACATCAC
CAGCCACTCCCCTGCTTGCTCGGTCGGCCAACGCGACTCGAGCACGTGGTGCTCATCTGC
TGGGGTCGATGTTCCACGATTAGGAGATCGTGATTATTTCGAAGCTATTTTTTTATTTAT
TTAATTCTCCCGTTTCTCACGACACCAAATATGTCCTCTCATTCATTTACACAACCGTCC
ATAATACTCGATTCCGAGCAGCACATTTGTAAAATAAATGCTTATTAGCCCACTTTTTAT
AACAGTTTTATGAATTTGCTTATTGTATTCAAAGTCTTTCATAGTTAATTTATTTATATT
CCCAATCAATCTCAAATTCTAATAAAGCCATAGTGAAGCAACATTCGGTGATCACAACAA
AAAGTTCAGTTTTTCGAAAGAAACGTGCATTTTCACGATAAAAAGGTCCCGGAGCACAAT
TGAGACGCAGAGAAGTGGAGAACGGGCAGTTGCTCGTCTTCTTCTCACTTGTTGTTCTGC
ATTTTTGTCGATACTCTAGACGAATTTCGGTTTTTACATAAATAAAAGCTTTTACAAATG
CATTTAAAAAATAAATAAGCATTTTAAGTTAAAGGTGCATAGAGTATCTGACGTAAATTG
GTCCCACAACGAAATTGGTCGGTATGCGCGCGAAAATTAATTTTGAGCTTTGTTTTCGTT
GCAACCACCATTTTGTCGGGAAAAGTTATTCTAACTTCCCAAAGCTATTTCGTAGCCGTT
TTATTCATACTGTCTATCTTCCTTTTATTTATTCTTTGTCATTATCTTCTGAAATCTTGT
TTTCATTTCAGAGAGAGCCATGGCACAGCGACACGTCAGCGTGGGATGCTTTTCGACGTT
CAGCGAGGCTGAGGCGAAGGTAATGCTTTAAGCGTGCTTAAAACTTATCAAACATAAGCA
TCAAATGCTGATAACTGTGTGCGCCGCCCATCGTACATATCGCCCAAAAAAAATAATAAA
AATCTGTAACCCGCGCTGCAACAAAAATACAAGTACGAACGATTTTTTTTCTATTCCATA
TACTCTTTTTTCCTCTCCCGAAAGAACGACACGTTTCCAAAAAAGAACCGACTGTGTATA
CAAATCATTGTTGCAGTTAGTTTGCAAGGGAAGAATATATATTTTCGTGGATAATGACTC
CGTTTCCGGTGAGTATCGTGATCTTCTTGAGAAACCATTTCAAAAAAATTATTTTTTGGG
GAAGACTACAAAGACTGAGATCAAAATGCTCGTCTTCTCGCCCACCGGAGAGTAAATATT
TAGTAGCGAAAAAATATATACAAATACGTAGACAATGTCTAAGGAATTTGCGCTTCTGTG
GTATATAAATGAGAAGTCGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 1170..1281, 1332..1824, 1875..2246, 2434..3186, 3233..3701
1020..1125, 1170..1281, 1332..1824, 1875..2246, 2434..3186, 3233..3439
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved