Caenorhabditis_elegans Locus prp-8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans prp-8
Caenorhabditis_elegans
prp-8
III
C50C3.13, C50C3.14
2164..2296, 4867..5007
10326
GGTTATTCTGAAAATAAATTCAATTAAAAGAAAGCTATTCCCGATAATCTCGATAAAAA
TAAAAGAAAATGATTAAATTCAAAAAGACACAACAACTGGGAAACTCCGCGAATGAATTA
TTTACGAAAAGCAGGAGTTCTTTGTTAGAGTTACGAAATAAGCAATACGATTTTCGAAAC
CGATCTACGAAAAATTACACATATTAGAAAAGTATTAAAATTACGAAATCGCCGTTTGAT
ATTCGAAAATACTACCTTTTTTTTAAGTTGGACAGTTTTTAAAGTTTTCAAAAGGAGATC
TTCATGAACTCGTCTATGAGGAATAAATGTGGTACATTTCAATATAAAATGGGTAACAAT
GACAGTTTGGAAATAATTTCCTTTTCGAAAAATTGATATTTGTACAAAATTCGGAACAGT
TTCGAAAAAATGATATTACCCCAGTCACATGACTTGAAAAAGGAAAAGTTGCAATTCAGA
AGCTTTACTCAGATTCTGAGGGCAATAGAAAATGCCAATAAGTTTTCGAAAAATCAATAA
ATTTTTTCGGGCAGATGTCTTTCCTCGGCGGCGGCGAACGCGAACGCAAATAATGGCTGC
CAAGAAGAGGCGGGTCTATTGATCGAAACATTACGCCGAAGAGTGTTTGAATTACCGGGC
ACCGTAACCTCAAACACCTGCAGATCTAAGTACGACGCTCCACTCGACACAATTGCGCGC
GTTGTTTAGATTTAAGGAAATTTAAATTTTACTTTCGAAAATAGAAATTATCGGTTTTTA
TTCATGATTTTCTGGTTCAGTCTGAATAAATTCCGTTTTTTAATGTAAATTTTGTGCGCT
ATTAACTGTAATGCACAATTCCAACTATCAATTCATGTGATCTTACAGTCTAAACAAAGA
CAAATCTCTCTTTCCAGTTTCTCTACAGTAATACTTATTTTTCCTTGCTCGTCAACTCAT
TGATTAGTTTTAATTCTATTTTTATATAGTGTGTTATAGGTATGGCCAACTACGGCGGTC
ATCCCCAAACTGAACCACATGCTATCCCGGATTCAATTCTGGAAGAAAAGTCTCGAAAAT
GGAAACAACTTCAAGGAAAGCGGTATTCGGAGAAAAAGAAGTTTGGAATGTCCGATACGC
AGAAAGAAGAAATGCCACCTGAGCACGTCCGAAAAGTTATCAGAGATCATGGTGATATGA
CTTCTCGCAAATATCGTCATGATAAAAGAGTCTACCTCGGTGCTTTGAAATATATGCCAC
ATGCCGTTTTGAAGCTACTGGAGAACATGCCGATGCCCTGGGAACAAATCAGAGATGTAA
AAGTTCTGTATCACATCACCGGTGCGATCACTTTTGTCAACGACATTCCGCGTGTCATCG
AGCCGGTCTACATGGCACAATGGGGAACGATGTGGATTATGATGAGAAGAGAAAAACGTG
ATCGTCGTCATTTCAAGCGAATGAGATTCCCTCCATTTGACGATGAAGAACCGCCTCTCG
ATTATGCTGATAATATTCTGGATGTCGAGCCTTTAGAGCCAATTCAAATGGAACTAGATC
CAGAAGAAGACGGAGCTGTTGCTGAATGGTTCTACGATCACAAGCCTCTTGCAACAACTC
GATTTGTGAACGGCCCAACGTACAGAAAATGGGCATTCAGTATTCCACAGATGTCCACAT
TGTATCGTCTTGCAAATCAGCTGCTTACCGATTTAGTAGATGATAACTACTTCTACTTGT
TTGACATGAAAAGTTTCTTCACTGCTAAAGCACTCAACGTTGCAATTCCAGGAGGCCCGA
AGTTCGAACCATTGGTAAAAGATTTACATACGTAAGTGAAAAGCTTCCAGTTGTGTTATG
ACGCATACTATTTTATTATTTTCAGTGATGAAGACTGGAACGAGTTCAATGATATCAATA
AAGTTATTATTCGAGCTCCAATTCGTACCGAGTACAGAATTGCATTCCCATTCATGTACA
ACAATCTGATCAGCTCGCTGCCTGTTCAAGTTTCATGGTATCATACTCCTTCAGTTGTAT
TTATCAAAACTGAAGACCCAGATCTTCCCGCATTCTACTATGATCCATTGATCAATCCAA
TCGTTCTCAGCAACTTGAAAGCAGTGAGTTATTTACAAGTTTCAGCAATGTTTTAAAATA
AAATGCGGATATTATAAACAGATTCCTATAAATTTACAAGGTAGTCAGTAGCCGAAATTC
GCAATATAAATTTTCCATTAAAGGCGAGAAATCATCCTTTTTGTCGGTGATATCTAGAAA
TAAAACTGGAGACAATTCGTATTGTATGTCAAAACATTTTCAGACTGAAGAAAATCTACC
AGAAGGTGAAGAGGAAGACGAGTGGGAGCTGCCTGAAGATGTTCGACCCATTTTTGAAGA
CGTTCCACTCTACACCGATAACACGGCTAATGGTTTAGCACTTCTATGGGCCCCTCGGCC
ATTCAATCTTCGATCGGGAAGAACGAGAAGAGCAGTGGATGTACCACTTGTCAAATCGTG
GTATAGAGAACATTGTCCAGCAGGTTAGTTTTGTTTCTATTTTTTTCGTTTCGTTTCTCG
CATACTAAGCTGAAATAATATATTCAATTTTTCAGGAATGCCCGTGAAAGTTCGTGTTTC
TTATCAGAAACTGCTCAAGGTGTTTGTTCTGAACGCTCTCAAACATCGTCCACCGAAGCC
CCAGAAGCGTCGTTATCTGTTCCGTTCCTTCAAGGCAACAAAATTCTTCCAAACAACCAC
CCTGGATTGGGTAGAAGCTGGATTGCAAGTTCTTCGTCAAGGATACAACATGCTCAATTT
GCTCATTCACCGAAAGAATCTCAACTATCTTCATCTTGATTACAACTTCAATTTGAAACC
AGTTAAAACATTGACAACAAAGGAAAGAAAGAAATCTCGTTTCGGAAATGCATTCCATTT
GTGCAGAGAAATCCTTCGTCTCACAAAACTTGTTGTTGATGCCCATGTTCAGTATCGTTT
GAACAACGTCGATGCGTACCAACTTGCAGATGGTCTACAATATATCTTTGCTCACGTCGG
TCAACTGACCGGAATGTATCGTTACAAGTACAAGCTCATGAGACAAGTCAGAATGTGCAA
GGATCTCAAGCATCTCATCTACTATCGTTTCAACACTGGGCCGGTTGGTAAAGGACCTGG
ATGTGGTTTTTGGGCTCCGGGATGGAGAGTTTGGTTGTTCTTCTTGCGTGGAATCACACC
ACTGCTCGAGAGATGGCTTGGAAATCTGTTGTCTCGACAATTCGAAGGAAGACATTCAAA
GGGAGTGGCCAAGACAGTCACCAAGCAAAGAGTTGAATCTCATTTCGATCTTGAATTACG
GTAAGCTTTAAATGGCAAGAAAACGAATTTATTTATTAATATTTTCAGTGCTGCTGTCAT
GCATGACATTCTGGATATGATGCCGGACGGAATCAAACAAAATAAGGCTCGTGTTATTCT
TCAGCATTTGTCAGAGGCGTGGAGATGTTGGAAGGCTAATATTCCATGGAAGGTTCCCGG
ACTGCCAACTCCAGTTGAAAATATGATTCTACGTTATGTGAAAGCAAAGGCTGATTGGTG
GACTAATTCGGCACATTACAACAGAGAACGTGTAAGACGAGGAGCGACAGTAGACAAAAC
TGTGTGCAAGAAGAACTTGGGTAGATTGACAAGATTATACCTGAAATCAGAGCAAGAAAG
ACAACACAATTACTTGAAGGACGGACCATATATCTCTGCAGAAGAAGCTGTTGCAATTTA
CACGACTACAGTACATTGGCTGGAATCAAGAAGATTTTCTCCGATTCCTTTCCCACCACT
TTCTTACAAACACGACACAAAACTTCTTATTTTGGCTCTTGAAAGACTGAAGGAAAGTTA
CAGTGTGAAGAATAGATTGAATCAATCCCAAAGAGAAGAACTGGCTTTAATTGAACAGGC
TTATGATAATCCTCACGAAGCTTTGTCTCGTATCAAGAGACACATGCTCACGCAGCGTGC
ATTCAAAGAAGTCGGAATTGAGTTTATGGATCTCTACACTCATCTTATTCCAGTCTACGA
TATCGAGCCTCTTGAGAAAGTCACTGACGCTTACCTCGATCAATACCTCTGGTATGAAGC
AGACAAGAGAAGATTGTTCCCGGCATGGGTGAAACCAGGAGATACTGAACCACCACCGCT
TCTTACATACAAATGGTGTCAAGGTCTCAACAATCTTCAAGATGTTTGGGAGACAAGTGA
AGGAGAGTGTAATGTCATCATGGAAACAAAATTGGAGAAAATTGCTGAAAAAATGGATTT
GACACTTCTCAATAGATTGCTCAGATTGATTGTGGATCACAATATTGCCGATTACATGAC
TTCGAAGAACAACGTTCTCATCAACTATAAGGATATGAACCACACCAATTCTTTCGGAAT
TATTCGTGGTCTACAATTTGCTTCGTTTATTGTTCAATTCTATGGATTAGTTCTTGATCT
TCTTGTTCTTGGACTTCGACGAGCTTCCGAAATTGCCGGTCCGCCCCAATGTCCAAACGA
GTTCTTGCAATTCCAGGATGTTGCCACAGAAATTGGTCACCCTATTCGTCTCTACTGCCG
GTACATCGACCGAGTTTGGATCATGTTCCGTTTCAGTGCTGATGAAGCACGTGATTTGAT
TCAAAGATACTTGACAGAGCATCCAGATCCGAATAATGAGAATATTGTCGGTTATAACAA
CAAAAAGTGTTGGCCAAGAGACGCTAGAATGAGATTGATGAAACATGATGTCAATTTGGG
TCGTGCTGTCTTCTGGGATATCAAGGTAAATTTTATTTTTAATTATTTTTTTAAAATTTT
AACACGAGGTATAAGAAAGCGAGCAATTATTCGATGGCTGCTCGTTGATAATTCCTCGAA
AACTAATGGAAATTAAGCGATTATCCGCCTCATGAACAGATCCATCATTTAACTTGAATG
ATAAGGTCTACTTGACAGGCGTACATTAAAATGTAGAATTTACTATTTTGATTTTTAAAT
ATTTGTTATTTTACAGAACCGTCTCCCACGTTCCATCACAACTGTCGAGTGGGAAAATTC
ATTCGTATCAGTGTACAGTAAGGATAACCCGAACATGTTGTTCGACATGTCCGGATTCGA
GTGTCGTATTCTACCAAAGTGTCGTACGGCTAATGAAGAGTTTGTTCATCGTGATGGTGT
ATGGAATCTTCAAAACGAAGTGACAAAGGAAAGAACTGCTCAGTGCTTCTTGAAGGTCGA
TGAGGAGTCATTGTCCAAATTCCATAACAGAATTCGTCAAATTTTGATGTCTTCTGGATC
TACAACGTTCACCAAAATTGTCAACAAATGGAATACAGCATTGATCGGATTGATGACCTA
CTTCAGAGAAGCTGTTGTGAACACTCAAGAACTTTTGGATTTATTGGTGAAATGTGAGAA
TAAAATTCAAACGAGAATCAAGATTGGACTCAACTCAAAAATGCCCTCAAGATTCCCTCC
AGTTGTTTTCTATACGCCAAAAGAAATCGGAGGACTTGGAATGCTATCTATGGGACACGT
CTTGATCCCACAGTCTGATCTTCGATGGATGCAACAAACGGAAGCTGGAGGTGTCACTCA
CTTCCGTTCCGGAATGAGTCACGATGAAGACCAATTGATTCCAAATCTGTACAGATATAT
TCAACCTTGGGAAGCAGAGTTTGTCGATTCTGTTCGTGTGTGGGCAGAATATGCGCTCAA
GAGACAAGAAGCCAACGCTCAAAATAGAAGACTCACTTTGGAAGATCTCGACGATTCATG
GGATCGTGGAATTCCGAGAATCAATACTTTGTTCCAAAAAGATCGTCACACATTGGCATA
CGATAAAGGATGGCGTGTTAGAACCGAATTCAAGGCTTATCAAATTCTGAAGCAAAATCC
ATTCTGGTGGACACATCAAAGACACGACGGAAAGTTATGGAACTTGAACAACTATAGAAC
AGACATGATTCAAGCACTTGGAGGAGTAGAAGGAATTTTGGAACATACATTATTCAGGGT
AAGTGTTAACAGATATAATTTGCTTTCTTGTCTTATATGTGTATTTTTAGGGAACCTACT
TCCCAACATGGGAAGGTTTGTTCTGGGAACGTGCATCTGGATTCGAAGAGTCGATGAAAT
TCAAGAAACTGACAAACGCCCAACGTTCTGGACTTAATCAAATTCCGAATCGTCGTTTCA
CTCTCTGGTGGTCTCCAACTATCAACCGTGCTAATGTCTACGTCGGTTTCCAAGTACAAC
TCGATTTGACTGGAATTTTCATGCACGGAAAGATCCCGACGCTCAAGATTTCTCTCATTC
AAATCTTCCGTGCTCACTTGTGGCAAAAGATTCACGAGTCAGTAGTTATGGATCTGTGTC
AAGTTTTCGATCAGGAACTCGATGCACTTGAGATTCAAACAGTCCAAAAAGAAACTATCC
ATCCGAGAAAGTCTTACAAAATGAACAGTTCGTGTGCCGACGTACTTCTCTTTGCTCAAT
ACAAGTGGAATGTGTCTAGGCCTTCTTTGATGGCAGACAGCAAGTGAGTTTATGTGAAAT
GTTGTTTGAAAATGATATACTTTTAGCAAAGATAATTTTCTCAAAAATTTCTGAACTTTT
CTTTTAAATAGTTAATTTTAATTTTTCAGAGATGTCATGGATAACACCACAACTCAGAAA
TATTGGCTCGATGTGCAGCTTCGTTGGGGAGATTATGATTCTCACGACGTTGAACGATAC
GCCCGTGCAAAATTCCTTGACTATACCACTGATAACATGTCGATTTATCCTTCACCGACT
GGAGTTCTCATCGCAATCGACCTCGCGTACAATCTATATTCTGCGTACGGAAACTGGTTC
CCAGGAATGAAACCATTGATTCGACAGGCGATGGCAAAGATCATCAAAGCCAATCCAGCC
TTCTATGTGCTGCGTGAACGTATTCGCAAGGGTCTTCAACTCTACTCGTCGGAACCAACT
GAACCTTATTTGACAAGTCAAAACTACGGAGAGTTGTTCAGTAACCAAATTATCTGGTTC
GTTGATGATACCAATGTCTACCGTGTCACCATTCACAAGACATTCGAAGGTAACCTAACG
ACCAAGCCAATTAACGGAGCCATCTTCATCTTCAATCCACGTACTGGTCAGCTTTTCCTC
AAGATCATTCATACATCCGTATGGGCTGGACAGAAGCGTTTGTCGCAGTTGGCCAAGTGG
AAAACAGCAGAAGAAGTTGCTGCCCTCATTCGTTCGCTTCCAGTTGAAGAACAACCACGC
CAGATCATTGTAACAAGAAAAGCTATGCTCGATCCATTGGAGGTGCATCTTCTCGATTTC
CCGAATATTGTCATCAAGGGATCTGAGCTCATGTTACCATTCCAAGCTATCATGAAGGTT
GAAAAATTCGGTGATTTAATTCTCAAGGCCACCGAGCCACAGATGGTGTTGTTCAATCTG
TACGATGATTGGCTCAAGACAATTTCTTCATACACTGCTTTCTCTCGTGTCGTTCTTATC
ATGCGTGGAATGCACATTAATCCAGATAAGACTAAAGTTATCTTGAAACCAGACAAGACT
ACTATCACCGAGCCTCATCATATTTGGCCCACACTTTCTGACGACGATTGGATCAAGGTT
GAATTGGCTCTGAAGGATATGATTCTGGCAGATTATGGAAAGAAGAACAATGTGAATGTT
GCTTCATTGACTCAATCTGAAGTCAGAGATATTATTCTTGGAATGGAAATCTCTGCGCCA
AGCCAACAACGTCAACAGATTGCGGATATTGAGAAACAAACGAAAGAGCAGAGTCAAGTT
ACTGCAACGACTACACGAACTGTCAATAAACATGGAGATGAAATTATCACAGCAACTACA
TCGAATTACGAAACAGCATCGTTTGCTAGTCGTACAGAATGGAGAGTTCGTGCTATTTCA
TCCACAAATCTTCATCTTCGAACTCAACACATCTATGTCAATTCCGATGATGTCAAGGAT
ACAGGATATACTTATATTCTTCCAAAGAATATCCTCAAGAAGTTCATCACTATCTCGGAT
CTTCGAACACAGATTGCTGGATTCATGTATGGTGTATCGCCACCTGATAATCCACAAGTA
AAGGAGATTCGGTGCATTGTCCTCGTTCCACAGACTGGAAGTCATCAGCAAGTCAATCTT
CCAACACAACTTCCGGATCATGAGCTTCTTCGCGATTTTGAGCCACTTGGATGGATGCAC
ACTCAACCAAATGAGTTGCCACAATTGTCTCCACAAGATGTCACAACTCATGCCAAGGTA
ACATAATTTAGGATATTTGTAGTCAAAAATTATAATTGAACTTGCTACATTTAAAAAAAT
TATCCCGAAGAAAATATTCTCAAAACGAAATGATAACCTGGATAAATGTAATATTTCAGC
TATTGACCGATAACATCAGCTGGGATGGAGAAAAGACAGTGATGATCACGTGCAGTTTCA
CTCCTGGATCTGTTTCTCTGACTGCATATAAACTTACACCATCGGGATATGAATGGGGTA
AAGCGAATACCGACAAAGGAAATAATCCAAAGGGATATATGCCAACTCACTATGAGAAAG
TGCAAATGCTTCTATCTGATCGATTCCTTGGATACTTCATGGTTCCATCAAACGGAGTGT
GGAACTACAATTTCCAAGGTCAACGTTGGTCGCCTGCAATGAAGTTCGATGTGTGTCTTT
CTAATCCAAAGGAGTACTATCATGAAGATCATCGGCCGGTTCACTTCCATAACTTTAAGG
TATTCGATCTAGTTCTAAACAATTTTAATATTTCTTTCATTTTAGGCATTCGACGATCCA
CTTGGAACAGGAAGCGCCGATCGCGAGGATGCATTTGCATAATCATTTTTCTTATTTTAT
CTAAAAATTTATTATTTTTTCTCTTCTAAGGACCTCCATAATTTATTCTCATTTTGTTGA
ATTTCATTTTTTGGTTTTTTTAATCACTAATCTATTTCTCTCGTTTTTTCTCTTCCCTTC
GAATCTCCTAAGCAACACTGTGTGTATTTTCCCAAACCCCCTCCCAGTCCTTTTCAACCA
AATAAGGTTCGTTCTGTCAGAAATTTAATCCTGAAATTTTATCATTAGTCTTGACGTTTT
TATTCCTCTTTTTTGTTCTCATGGTCCCTGAAATTGTAAATTGGGAAATGTATGTTTCTC
CCACCTTCCTCCACTATTTGTTTTCTATATAAAGTGAAGGTATTTGGTAAAACGTACGAG
ACATCTCATCATCATGAATCCATTTTTCATTCCGTGTTGTTTCGTGTTCGGGATTAAAAC
GCGGTCTCCATTAGTTTTCCAAATCTCCGCCCCATTTCTTCTTCCGAGTCCGTAGGTCAT
CAAGAACCGCGACATTTTGAAAATGATGATCTTGGGCAAACAAAGCGACAAGCTCAAGGA
AACGGCCGAAAGTCAGCTGTCGTTTAGAAAAGAAACTAAGCATCATCTCTGGACGAATTG
CTTCACTACTACTGCCAGAGAGAGGAAATTCCTTTTTGCTTCGTTCTCACTCTCGGTTTT
TTTGTTCTTTGAAGTGTCTGTGTTGACTTCGAAAATATGAGCCATCAATCAAAATTTATA
ACTGCCAGTGTGCTGGTGTTCGTTTTTTACTCCATAGACTTCCCTGACTGCACAAAAATA
AACATCTTTGTGACGAAAAAACGTTGCTGTTTTTCTAACTTAGTATCTATCCAACTTCTT
CGCTAGATTTTAGAGCTGCGAATAATGGAGAAGGAGATCCCAAAAACTTTGAATTTTTCA
TAAAGAAATCGCGCCCGCCTGCACTGTTCAATTTTCAAAAAATAATATCACCCAGAAGCG
AAATTTTGCGATTTCAGCGCCAAAAATACGGTACCCGGTCTCGGCACGACATTTTTTCGT
TAAATGCGTAAAGGTACGCGCCTTTAAAGAGTACTGTACTTTCTAAGCTTCATCGAATTT
AATTTAAAGTTTTTTCGATAAATCTATATTTATTTTTTAAAAAACCCATCTCAAGAAAAA
CATTATGAAAAAAAATTCCGGAGCAGCAAAAGAACTATAGTAATCTTCAACAGCGCACAC
CTCTTAGTGTCTAATAAAAATTTGCCTTATTAAGACCGGTTACGGTAATTTAGACGCAAA
ATTTTAAATCATGTACAGAATTGTTCTGGTAAAAATAGATTTTGTTTCATTTTCATGAAA
ATTTTTGAAAAACTAGAATACCTTCTCAATTTTCCTTTTTGTTCTACTACAATTTCCATC
TGCCATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1830, 1885..2122, 2323..2542, 2615..3359, 3408..4824, 5056..6057, 6110..6582, 6689..8336, 8459..8818, 8865..9326
1001..1830, 1885..2122, 2323..2542, 2615..3359, 3408..4824, 5056..6057, 6110..6582, 6689..8336, 8459..8818, 8865..8918
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved