Caenorhabditis_elegans Locus cgh-1
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans cgh-1
Caenorhabditis_elegans
cgh-1
III
C07H6.10
2181..2258
4515
GAGGAAATCGAAAAACGATAAAGTAATCACATTACTCATTACATTTAGAACTAATTATC
CTTTAATAAATTTTCATCGACGCTGGTATATTCTTTTTAATATTTAATTCATTATTATTC
TCAAGAAATTTCGCATCAAATCTTCGTAAAGTTTTTCATTGAAATCTAATTTTGAATTAC
CGCCATTTTGTTTCGCGCGTTGGCTGAGTATTCAACTTTTGTGTGTTGAATGTACGCAGC
GAAATGCCTCTCACTCGTCGCTCGCAGCAGCTTGGCCTACTCGTCCCGTCGCTCTCACAG
TTTTTCTCTCCACACTCTCGTTTCTTCGCACATTTCCTTCATTTTGGCCGTTGTTCTCCA
CGTGTTTCTGTGTTTCTTCTCTAGATTTCTAAGAGTTTTAGGCGACGATGGCAGCTCCAA
TCTGTTATCGACACTTTCTTGATAGATTCAGTCGTTTTCCGAAGATTTTTATCAGTTTCG
TAGCTCAGAAACCTGTTTTAAAAAACGATAACAAAAAGTGTTCTTTCAAACTTTCGAATG
TAAAATATAAACTTTTTCGCGTTTATTGTTTGGAGAGTCGCTTAAAAACTGGAAGGTATC
AATAAAAAATTGTCGTGATTCTCTGACCTTTTGAAATTGTTTCTTGTCAATTGCCACGTC
GTCAAACATCGGCTACCCTGTTGGCTAGATACTCCAGCAACCCAAAGAGTGTCTGTGCGT
CTCTATGCGCCGCCGACCACTCGCTTGCTTTTTCTAACCGTCATTGATCGTGTGTATACG
AGCGCGAGACAGACACCGGTTGTCTCGCATAAATATTATCTCAGTGTTATTTAGCGTTCC
TCCTAATTGTTCTGAAAATGCTTGAATGATTTTTCCATGACTAACAAAATTGTAGTAAAC
TCGATAGGTATCATTTTTTCGCATTAAAAACTTATCTTCCTTCATTAACAACTTCTCAAC
TTACACCATTAACAACTTCTCAACTTTAATCTCGATTTTACAGATCTCATCAGGAAATCA
AACCTACTACGACATCGGAAAATGAGTGGAGCGGAGCAACAACAGATCGTTCCTGCCAAC
AATGGCGACGAAAACTGGAAGGCTGGTCTCAATCTTCCAGCAAAAGACAGAAGATTCAAA
ACTGCTGTGAGTTTGCAAAGCCTATATGACTTTGTGACCATTTCATTTTTCAGGATGTCA
CTGATACGAAGGGAGTCGAGTTTGAGGATTTCTGCCTTGGACGCGATCTTCTCATGGGGA
TTTTTGAGAAAGGATGGGAAAAACCGAGTCCTATTCAAGAAGCATCCATCGGAGTCGCTC
TCACTGGTCAAGATATTCTCGCAAGAGCTAAGAACGGAACAGGAAAAACCGGAGCTTATT
GTATCCCTGTTATCGAGAAGATCCAGCCAGCCCTCAAAGCTATTCAAGCCATGGTCATTG
TCCCAACTCGTGAATTGGCTCTCCAAACTTCACAGATCTGCGTGGAGCTCTCCAAACACA
TTCAGCTCAAAGTTATGGTCACTACCGGAGGAACTGATCTCCGTGATGATATCATGCGTC
TAAACGGAACGGTTCACTTGGTCATCGCCACCCCAGGAAGAATTCTCGATCTTATGGAGA
AAGGAGTCGCCAAAATGGAACATTGTAAAACACTTGTTCTTGACGAGGCTGACAAACTTC
TTAGTCAAGACTTCCAGGTAAAAAAATTAACATTTGAATAAGATAACAATTCTCGTTTAC
AGGGAATTCTCGACCGCCTCATCAACTTCCTCCCAAAGGAGCGTCAAGTTATGCTTTATT
CTGCCACTTTCCCTAACACCGTCACTTCGTTCATGCAGAAGCACATGCACAAGCCGTATG
AGATCAACCTCATGGAGGAGCTTACTCTTCTTGGTGTCACCCAATACTATGCCTTTGTTC
AAGAGAAGCAAAAGGTCCACTGTTTGAATACGTTGTTCCGAAAACTTCAAATCAACCAGT
CGATCATCTTCTGTAACTCTACTCAACGTGTTGAGCTTCTCGCTAAGAAAATCACGGAAA
TCGGTTACTCGTGCTACTACATTCATTCCAAGATGGCTCAGAATCACAGAAACCGTGTCT
TCCATGACTTCCGTCAAGGAAACTGCAGAAACTTGGTTTGCTCCGATCTTCTCACCCGTG
GTAAGTTTGACTAAATAATTTGCGCGATGAGGATTGATAACACATACACACACTCTGAAG
TTATGTGAAGAGATAATTGAAGAACGGATATCTGAGCGCCATTTTTCTTATTTTAAAGTG
TAGTTCATGCATAATTGTAATTTTTCAGGTATCGATATCCAGGCTGTCAATGTTGTCATC
AACTTTGACTTCCCAAGAAACGCCGAGACTTACCTTCACAGAATCGGTCGCTCTGGACGT
TTCGGTCACCTCGGAGTTGCAATCAACCTTATCACCTACGAAGACCGTCACACCCTTCGC
CGTATCGAGCAGGAGCTTCGTACTCGCATTGAGCCCATCCCGAAAACGGTTGACCCGAAG
CTGTATGTCGCTGACCAGCAGCTCGTCGATGCCGCCGATGAGACCACTGCTTAAACACTA
GTTCTCATATCCCCAAACCTCCAAAACACACTGGTCGCCTACGTTTTTTTTTTCCATTCT
AGTGATCTCGTCCAGATTGTGTATGTTCTCTATTTTCCTTTAAATGCACAGTTTGTGCTA
AATTTAATATTGTTCAAGCATAAGCATCTTTCCTTCCTGTTTTCTCAAATCCCCGCACAT
TATTTGTATCCCATCCACCTTCCCGGACCCCATCAACCCGTTCCACTTATATGCGGTGTA
AAATTCTAATTTTTCTTTTTCATTAGTTTCCCCATACCCTCCAACTTGCAGTCATGGACT
GTAACTCATTCAAGTCGTTGTGTTTTACATAGTCATTTAAGTTGGTCTTTATGCTCCCAA
AGTAAATTGTTTCGACATTAATGTGTCGTTGCAAAATATATTTGGGAGTGTAAGGACATT
GTTCATACACATCGGGTTCTTTTTGACGTGTATCATACTGGGTAGCCGGCTCTGTAGTTA
TTCTGTTGAGCCGCACCACATTGATCAATCTTGTAATTTCCTATCTCATTTCCCACAATT
CTCCCTTCATGCCCCATACCAATGCATCCAAAATTTAAAACCACCATCCTTGCGGTTTTC
CCTTGCCCATCTGTAGGGTTTTATTCCGCTCTTGTGCTCATTCCAGTTCAACTTGTCCAT
CTCCTAATCTGATAGATATTTATTGCAACTATTATCATGTCAAATGGCTCAAAGACTATA
ATGTCTTGGAAGGCTTCCGGCTGGCCATGTGTCTCGCTTACAGCTCTTCCCCCATCCCCA
TTCCAAAACCATTTGTTCTCTCCCGCCTCCTCCCTCTTGTTTATTGTATAATTTGTAGAA
GTTGACACCAAAAATTTGCACAATTTTTCGATTCACAAAGGATGTGCAAGCTTCCTTCTG
GATGATTGCCATCTTTAACAATAAAAGACCGAATCGAAACATCGTCTTCTGTTATTTCTT
TTCAGAGTTTCATATGAAGAGGAAAGTAGTGAAAGCCTTGAGAAAAACCGAAAACCCACA
AGAGATACATTAAAGCACATTAGCGCATTTCCCGAGTGAAAGACCATGTGAAATGAAAGT
AACAAAATGCGACGATTTACTTTCGTTTCTCGTATTCCCTGGCAACAGCAGCGGAAGGCG
TTGAATGTGTTGACAGTCAGCCAGCGGCAATGGTTGAGGTCGGTATTCAATTTACTGTTT
CTCTCTTGGATGTGTCATCCGGAGAGGTGATTGCCCATCCGTATCGGCACCAGTAATCGC
GCCGCGCACAGTAATATTAGTTGATATTGCGGTGACGGGAGAGGTCGGAACGTCTACATT
AATCTATTAGTGTGTATTCGGATTCCGACCGCAATGACTTTGAAAATTCTTTTTAGTTTC
ATTTTCTCATATGCTTTTCTATATGTATATCCTCGCCTTTTGTAATATTATGCAAATGTT
AACAATCCGTATCCGTCGATGACAGGCGGCTCGAACCGGTCTGAATTGGATTGGAATTCT
TTGCGCGATATCCGCAGAGAGACAAGTGATGGCATCGAAACTATTTTTTTCTCTGATTTT
TATACGGTTTAGGCATCTTTTTTTTTAATTTTAATCAAATAACAAAAGTTTATAAAAATA
TAACTTTTTTGACCAACTCCATCGATAAATCACGAGGTTAGTCTCGTATTACTCACATTT
ACTGCATTGTACAAAATGACCATTTTCAGAAAATTTTCCAGACGAACGCGCCCGATTAAT
AAATTGAAATAGTCTTTCATTTTTCGTTGATGATGTTATAATGGAAAATAATGCGAAGTA
CAACAAAGTTTTATTGCCCAGACGCGAAATGTTGCGAGTTTTACGTAAACGGGTGTGCGC
CTTGAAAGATTACTGTACTTTCAAACTTGTGGTGATGCGGAGTTTTCATCGATTTTTCAT
AGTTTCACGATTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1145, 1193..1696, 1742..2159, 2308..3515
1041..1145, 1193..1696, 1742..2159, 2308..2570
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved