Caenorhabditis_elegans Locus rpl-6
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rpl-6
Caenorhabditis_elegans
rpl-6
III
R151.11, R151.12, R151.13
1182..1313, 1588..1718, 1969..2099
3431
ACCAATTTGTATCCATTATTTCAATTCCATATTTTATCCTGTAACCTACAGAACTCTTA
CGAAGCTACGGGCCAATTCCTAATCAAACCAAATTGTTATAATCCTTATTTTCACTGTTT
CATTTTTCTTCTTCTAAATTAAATACCACCTCTTTTTATGTTGTTTCGAGTTTGTGTGTA
TGATTGAACGAGTTTGACCATGTTTTTGATATAATAAATATTTTTGATGCTTTGTTTGGA
CAGACAGCGGTGGTATTGGCGAATAGATCATGAGACTTAGATGAAACTCGTTTTAGAAAC
CTTTTCAAGAACTTCGAAAATATTTCCGCTGGGTGATCTGATCGAATTTAAGATGGGGAA
AGATTTTTTACTGAATAAATTATCTGGTGAGGAATTACAATTCCGATCTGTTTTCATTTG
ATCATTTTTCAGGTACCTGATCAGGTGCAAAAAACATTTTACATTAATAATTTTCGTTTT
GAAAAACTAATTTTTAAAATTTATGACAGATAATTAACAATTTTTTGATTTAATTATAAT
TATTATTATTGCCTAAATAACTTTCTGAAATATATAAAAATAAACATTTTTCATGAAAAA
GTTGCATTTTGTGTTGAAGAACAGGGAGAAATAACACACGTAAAACGAGTGTCACCGTAG
TCAGACGCGGGTCTCGCCGCGACGAGGCATTGAATACTCAGGCAACAAGCCCTATTCGCT
GATTTTTTCGTGCTTTTTAATTCTTTTTTCGATTTTTACATGTTTTTAAGAAAAAATAAC
GTTATTTCCAGTTTAAAAATGTAAAAACATGATTCCCATTAAAATTCTGGTTCATTATTC
AATTTAATTCTCTGTTCTTTTTGCCAGAAATCGTTTTTTACATGTTTTTTAAATTTTAGG
ATTCATATTGCTTGATCTCTTTTTTAATCAAAAAATAATTTTTAATCATCCAATTCATAA
TATGTCTGTCGTTTTTGTTAAATAGTTGGTCAGAGTTGAAATTAATTATTTTGCAGGGTA
CAAAATGGTTGGAAAGAGAAACCTTCCGGTCATCAGCAGAAACTTCGACCTCTCCCCAGG
AGTGCTCCGCTTCTCTGCTTCCCGACTTCGCCTGAAGAAAGGAGAGAAGAAGCCGAAGTT
CACCAAGGACACTGTACGTTTTTTTCTCAATAAAATCTCTTAAACGAGGTCCAGAGTCAC
CTTTTCAGCAAAATGCAGTTAGGGTGCTAGGATTTCTCGAAAATGAAATTGGTCGTATTA
TGCAAGTAGGGCTTGCTTTTGCGCTCCCCGACTTCACCTCATTCCCAAACATTTCCTACA
AATTAAAAAACTTTCAAGATAAATTGTTTTCAAAATTTATACTAATCAAATTAGTTTTAG
AGCGCCAAGCTTCCAAAACTTCAAAGAAACGGAACGAAATTCGCTCTCGGACATTCCAAG
ACTGTCACTCTCCGCAAGACTCTCACTCCAGGAACTGTCCTCATCGTTCTCGCTGGACGT
CATAAGGGAAAGCGTGTTGTCTTCTTGAAGCAGCTCCCACAATCCGGACTTCTCCTTGTC
ACTGGTTAGTTGAACGCGTATTTCAAAGATACAGCATCGAAAATGGACGGACTTTCCCGA
TGGATCGTTTCGTATAATTTTGGTGCAAAATAGTAGAGAGACGCAGTGTTACTCTTCCTT
ACGTTACCTGTATCTGGAGAGTGTCAAGCGTTTCCCACATTTATTTTTAAAAGCTGTAAA
TTCAAATAAATTAAATGTTTAGGACCACACAAGATCAACGGATTCCCACTTCGCAGAATC
GGACAAGCTTTCGTGATCGCTACCTCACTTAAGGTCAACGTCTCCGGAGTCAAGATCCCA
GAGCACATCAACGACGAGTACTTCAAGAGAAAGTCCACCGCACAAAAGACCGGAAAGAAC
ATCTTTGCTTCCGGAAAGACCGAGTACACCGTAGGTTATTTATCATCGCTTTTTGCATTG
AAAAGGGACGGGCTATCTTTATGGATTGTTTCGTATAATTTTGATGCGAGATAATAGAGA
GGCGCACTGTTACTCTTCATCACTTTTTCTGTGAACGGAGAGTGTCAAGCGCTTCCCACA
ATTTCTGGAATAACCCATATGTAGATAAATTTTTAAAGTGATCTTTTCGATTTTCATATT
TATTTTTTGCAGGTCTCCGAGCAGAGAAAGAAGGACATCAAGACCGTTGATGCCCCAATC
CTCGCTGCCATCAAGAAGCACCCAGAGCACAAGTTCCTCTTCGGATACCTTGGAACGAGA
TTCTCACTCGGAAAGAACCAGTATCCACACAAGATGCAGTTCTAAATGTATTTTGTTATT
GAATAAATTGTTGACATTTGTTCGTTATTCGTCATCAATTTGTTCCTCTGCCGACATCGT
CAGTCAGATTCTGAATAAACTTGGAGCGTGTTAGCAGGTTTACTTGGTTGTTCAGGTGAA
AGATTGTCAGGCTACTTGCATCGTTGAGATTATCAACTACGGTAATCATACAAATTTTGT
ATTCGCGGTTTTTCAGAAAATTCAATTTGAAGAAAGAAATCGGCTAACTCGTTCCAGTGT
TTATCGATTTAAATATTTTCAATGAAGGGTACTCTCTTTCACATTAGAGCAAACCTTTCC
AGAGAATAACCTCCAAGTATTACCTATTAAAATCTCGATGTTTGGAGGCATTCGAGATCG
TCTATTTCGCTTCCAGAAGCACAATCGAAGTGCCCGCAACGAGTTTTTAGGAACACATCC
TACATTACCAGGTTAATAATGAACGAATGTACATAGTTTCTTTTCAGATATGTTATTTTT
CAAGCTTAATTTCTGAAGTTTTGCTACATTTTCATATTCTGACTGAGATTTAGAAAATTA
CAAAAAAGAGGAGCAAAGTTTTCTAGTGTTTGCATTTCCCACGAGACAAAAGAAAACAAA
TCAGAGATTAGTTTTCTCGATTTTGTTCCATTTCTCCTCGTCCTTATCACCTCAAAAGTA
TCTCAATTAGTTTCCAATTAAAATTCTCATCTACACAGGTGCCTTCTTTGCGTGCATTTA
TGCTTGGATAATCCGTTTCTTTTCGTTGCTTTTCTCCCGAATAAGTCATGCGTCTGTCAG
TTTCCATGTCTCTGCTCGCATACATATATTCTAAGAGACGACAGAGAAAATATTCATTTT
CGAGTTTTTGCGAGCGTTGCAAGCTCTGTTTGAAGATGAACTTTTTATTTTCTGGTATTT
CTTCAGCTGCTCTTACCTTCTTTTATTTAAAAAAAAATCACTGACCTACGTTTTTCTTGT
TTTTAATCGTTCCATGCCCCCATCGTTCAGAATTTCAAATCAATTGTTTTCTTCTTTCTA
TCCATCACAATCGGTCAACACACACATCGGCCTTTTTCTCCATCAAACAATATGTCTTTG
ACAAAAAAAATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 1380..1563, 1762..1949, 2172..2431
1024..1152, 1380..1563, 1762..1949, 2172..2321
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved