Caenorhabditis_elegans Locus rps-13
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rps-13
Caenorhabditis_elegans
rps-13
III
C16A3.11
1456..1589
2905
CGAGATGGGTTTTGCACTGACTTGTTTTGTTGATTTGCAATCCTATCCACATTCAGTTG
ATTTCTATTGTTCTGTCTTGATTGATTTTGTGGATGAGAATCGCCTCTTTGTTCTTGTAT
TTCGAGCTGACGACGCTGTGTGTTCTGCTGACCACCACGTCTTCTTCTATTTTGCGATGG
CTCCTGTTGTCTGGAATTTTGATTCGAATGTGTCGAGGCACCAATCGTCGGTGGAGGCAC
AGATGGATCGAAGAGAACCGACTGTGCTGGGTTGAATGTCGCAGCATTGGGGTTGAAGGT
GAAATTAGCTTCTGGCTGCATTTGTAAACGGCTTGCAGAGGTAGCTGAAATTTAAACAAT
TAGTTTAAAGCTCTTTAAAGTTATTTTTGCCTTTAATTACCTTCTTTTTGTCCTCTGCCA
CGTTTGTTTCCACTACCACCACGATGTCCTCCTCTCGGGTTCATCAAAGGCGCCGCATCT
AGGTTATCTGCGGTATTGGCTCCTACTTGTCGAGGAGCTTGACGGAAACGACCTCCTCTT
CCTCGACTTGCTCGGTGACGGGAAGAATTTGTGGATGTTGGAATACTAGATGATGTTCCT
TCAGTATCGGCCATAATTACTTTAGTCTGTAATTGAAACAGATAAATTATTGGAAAAATA
CTTTTCTTTTATATATTTGTGAAATTTTTTTATTTGAAAACGCGAAACATTGAGAAAAGC
GATGCAATGTTGTGCAATAGTTCAGATGACATGACCGACCACAAACTACACATTTGAAGG
GACATTGATTTTGCCCGCGTTGTCTCACCACGCGCGTTACACACGCAAAACGAGTGTTAC
CGTATACAACTTTTAGGACATTTTTCTTCGCTTGCTACATTTCCATTGCAATTCATTTTA
GCCAATCATAGGGCACTTTTCTTACCTTTGTTCTTTCATTAATTTTGTTAATTTCTTTAA
TCTTTACATTTTTACAATAAACTCGACATTTTATCATCTTCTTTCAGGTAATCCGCATCA
ACCATGGGTCGCATGCACAATCCAGGAAAGGGAATGGCCAAGTCGGCCATCCCATACCGC
CGCTCCGTTCCATCATGGCAAAAGATGACCGCCGAGGAGGTCCAAGACCAAATCGTCAAG
ATGGCCAAGAAGGTTTGCAATTGATCTGAGGAGTTACTTGGTGCGATTCCGATAACTACC
ATATGATCATCAACTGGGCTACCATTTTTCCAAGTTTGAAAATGGGCCCAGGAAATGTGA
AAACCGAGTTTTCGGTGTCCATTTCCTTTTGAAATTTACGACAGGCAGAGATTTTGTATT
TTAGGGTCTTCGTCCATCCCAAATCGGAGTTATCCTCAGGGATTCCCACGGAGTTGGACA
AGTCCGCCGTCTTGCCGGAAACAAGATCTTCCGCATCCTCAAGTCCAAGGTAATAATGCA
ATTTTTATATCAGTATACGCTCTTCAAAAGCACTGGTTATCGGACTCAGACTTGTCCATG
CCAGCCGTCAAAATGAGCAATATGAAATATCCTGTTTTTGGGTGAGGTGTAACTGTATTT
AGATTAGATCTCAATAACACGATGACAGTTTTCGTAGAAACTAGTAAAATTCAATCAACG
TCTTTTTCTAGTTTAATTATTGTTTTTTCAGGGAATGGCTCCAGAGCTCCCAGAGGATTT
GTACCATCTCGTCAAGAAGGCCGTCGCCATTCGCAAGCATCTTGAGAGATCCCGCAAGGA
CATTGACAGCAAGTACAGACTTATCCTCGTCGAGTCCCGTATCCACCGTTTGGCTAGATA
CTACAAGACCAAGCGTCAGCTTCCACCAACCTGGAAGTACGAGTCTGGAACCGCTGCTTC
TCTTGTTTCATAAGCATTGTTCTGACAATAAATCGTTGTTGTTTCAAATAATTCTTTTTT
GTTTTACCAGTAAATTCAAGTAAAGGGCTGTTCCCATAGATTGGAAGTCGTTCGGAAATT
TGACGTTGTCTTTTGCTCACATTTAGCACTTGATCTTCGACTTTTGGATTGACTCTTCGA
GCAAGCATTCTATATTCGAAATACTTCCATTGCTTTCACATTCCAAGAAGTTCAACGATC
CAATGTCTTTAGATTTAATGCTAACAAAAAATAAAACGAATATTTAATAATCCATCAGGA
TACAATAGAAAACCTCGTAGACAACATAAACTGAGATACAATAATGAAAATCTGGGGATA
TGTGGTGAGAGCTCATCTAAATGTTCGATGCCCACGATCTCTTCCACTCTTTCCAGCATC
ACGTGCAGGCTCTGCTATTCTTGATGCCTTTGGAAGTTCTTCTTTTTTTTCTTTTCGATC
ATCTTTGCGATCTTTTCGAGAGGACGATGTTGATTTTGAAGGCTCCTCTAGATCAAACTC
AATCGCTTTTCGAGAGCCTTTCTTGTCATCTTTCTTGGGAACTGGGTCGGGAAGCTGAAA
TAAATCACATTTTCGAAAGGAAAATTTTGAAAATAGCTTGAGAAAACGTTAATATCTTAC
CGCGGGTCCTGCCACTTCAAGCTTCTCATCGGACGGCTTGCTTTTTTGCTTCTGATCTTT
GAGAATCTTTTGTTCTTTCTGGTTTTCTCCATTTTCTCGCTTCCTTTCCTTATCCTTTTC
TCGTTCCTTATTATCCTTCTCCAACCGTTTCTCTTTTCCTGTTTCTTTGTCTTTCGATCG
TTCTCTTCTTTTCTTACCTTCTCCTTTTTCAGATTCTGTGTCCTTCGGAGATTCTTTCTC
ATCTTTCTTTGAAGGTTCATCAGACCGTTTTAAGCGATCAACAATTCGAGTCTTCTTTGC
AGGAGGGGGACTTGGAGTCTTCACTTCACCATCTTCAGTTGTTGGCTCTTTCTTTGATTC
TTTTGATCCGTGGGATGATTTCTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1151, 1324..1428, 1651..1905
1023..1151, 1324..1428, 1651..1869
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved