Caenorhabditis_elegans Locus B0393.3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans B0393.3
Caenorhabditis_elegans
B0393.3
III
B0393.10
1700..1840
4478
CATCTTCACCACGGAGATCAAATGAGCCGCTAAGAGAACCATTGAGGACTCCCCAAAAG
AAAGATAACTGGGCAAATGAAGTACAAATGATGGAAGAGCAGGTTTCAACTCTCCAGACT
CGACTGAATGAACAGGATATGATGTGTTGTCAAGTTTCTAAGGCATTAGGTAATGGATAT
TATCAACCTTCAAATCTTTTAGCCAATATAATGTTACAAATTCTTTGAATTCCAAAATCA
TTTTTCAGAAATATATGCCGAGGATGTTCGAAATGCGAAATCTAGTGAGCTATGCGCAGT
ACTTTCTCAAAATCTTTTGGAACTCAGTAAAACATTGATGTCCATCAAAACTGTCCCCGT
TGGTACGAGTCCTCCAAAACATAGTCGAAACGGAATTTCTGATATTCAGCCAAAGGTATT
ATGCGATGATAAATGTTTTAATAACCTTAAGAATTTTTTCAGCCACGGGATTCACAACCA
ATTCGACAACATAACGAAATGGTTGATATGGCAACAAAACGCCCTCCATTGTAACAATGA
TGTATTTATTATTTATTTGAATATATTTCTCCAATATCTTGTAATTTCTGGTTGATGTAC
ATAGTGTCGTTCCTTTCACCCAATTTATTTTTTTGACTTACCAGTTTCATTTTTCTTTAT
GACCTCTATCGCTTGCCATACCAAAAACTCCAACGGAGTTCCAAAGATTTTAGACCTGTG
ACTTATTATCGTACTTTGTATACAAATTTAAAATAAATACAAGCACATTCCAATTTACTG
TTTTTTCTGACTTACAGATATCCTCGTATGCAACTAAACGTTTTAAGTCTGTTGAGGTTC
TATTTTTCTTTCATTTTTGTACTTGAAAGTTTTCTATGCTTTTATTTTTGAATGTCCGCC
AACATCGGAAAATGCGCCAAGCACTGGCTGGCGCATCGCTTGCCATTTGCTTGCGCATTT
CCCGTGACGACGCGCGCGCGAAATTCGATTGCATTTCATTTTGTGTTGCAGCGGGAGGCA
TTCTCAACTAATCTGGATTATAATTATCTGCTGCAATGATGCTGCCAAACAGTTTCGCAC
ACTTCGGACACAACTTTCCCCAACCGTCACACTTTTCGTTACAAGATCTACGCGATGATG
AATTCGTGCAGGTGAGTTTTCGAGTTTCGATAACATTTCCTCGTGATTTATTTATTTTAA
GAATTCTGCATTGCTACAACTCAAAGACAGCATACTCGATATTATTGTGGAACATGTGCC
GCTGAAAGACCGCCTACTAAAACTTCGCCCCGTGTGCCATCGGTTGTCAGATTCGGTGAA
ACGGTCTGTGAAATCCGTCGAATTTCTCCGCGATGAGCTAGATTATTGCGATGACGCGAA
GATTTCGTTTTTTCTTGCTGTGTACGGAAAGAATGTACAACATATGAACTACGACCTATT
TCGATCCTGCTCTCTACGAGAGTATACACAATGGTCATGGCGGCAGTCAGTCATATCATC
GGTTACCAGGTGTCCACAGTTGAAACAGCTGGATATTCTCATATGCTGTCGTCATCGGTT
GAGAGATGGAGATTTACAAGTTATTTTTAAACAATGTAATCAATTAGAGGAGTTGAGAAT
GGATGCTAGCTACATCAATGGACATTGTTTTTCAGTAAGTCTTACTTTTACAAAAACTAA
CACTTATAATAAAGCAAATTGATTGTCGTGAATCTTGATCGGCGTGTTTATTTTACCCGC
GTTGATTGTAAAGGCCGACATATATCAAAATTTGACATTAATGCTGGAAGTTTCTGAAAT
AGTTCCATTTTTCTTCCAATTATTTCAAATGTCAAACAAACCAGAAATTATGGTAGCTCT
GATAAGTTCAATTGTTATTTCAGAAAGCTCCACAAACTCTACGAAAACTTGAACTGGAAT
GCTGCCAAACTTTGAATAAACAAGGCTTCATTGGAATGTGCTCTCGGCTTTTTAAACTTC
AGACGCTGCATGTATCACTGATGCAATGCATTGACGAACAATTGATAAAACGAATCGGAG
ATATGAAGAGCTTGAAAAATCTCTCAGTTGTTGCTGATCCAGATCAGAAGATGAACCAGT
TCAGACTCGCTGAAATTCGTCGGCTTTCAAAGCTCACAACACTTTGTCTTGATGGTGTCA
ATAATGTCACTGATAAGTTTCTCGGCGATCTCAGCGATTTATCAACGTCACCTGCTGGCT
CGAGCATTGAACATCTTTCTCTATCATTCTGTAAGAATATTGGTTCAAATGGAATTTCGA
AGTTGAAAACTCTTCCAAATTTGAAAAGCTTAAACTTGGACGGAGTGTCAAAAAGAGACA
TATCAACTGGTTTAGAAGCAATCGGACAGGCTGGACGACTTGAAAGATTGCTGGTTTCGG
AAGACACTTATGTCAATCCTAAAACGATTGCGGAGTTTGTGAACACATGTGAGAGCTTGC
GGACGTTAGATATTTCTGGAAATCATCGACTTAAAGACAAGTCATTTGCAGAACAAGTGG
TACGTGTTAATTAATTTTAGTATTTGTCCTGAATTCAATTTTTTCAGTACAGCGCCAGAG
CCTTCTCATTCGGAAAACCAATGGTTATTCTAACGGATTTCAAATCAATGTGGCGTCAGT
TACCTCCATTCTCCTATCAAAGCCGCGTCGAAATCGTTAACATCAATGATCGTTACCCGG
AAGAATACGTAGAGTCCTTGTCAGTGAATACAGCGCAACAGATTCCTCGTGGACATTTGA
TACCAGACCTTCGGCGAGGAAATCGCTATAAAATGCTTGACATTGCGTTGAACACTTCCG
GAGAGCAGCTAGTTGATCCCTCCATCTTCGAGCAACACGACCAGGAAAATCAAGCTCCAT
CATTTTCTCCCCCTGGTCCTCTAGCTGTATTGTCTGAAAAAGAGCAAGAAGAGCTCGCTC
GCATGTTAATGGAGATTCAGCCACCTTTCCAAGTGAGTTTTATTTAATCAAAAATGATTT
TTCAATTCGTTTATTTTAGAATGCTGATTGGTTGAATTATGACCCATATGGAATGTCAAA
TGTCTTCCAACCTTCTTATACCGACTTTGAAAATAGCATCACAGTCGGATCAGCAGGAGC
ACCAGGACCACCAAAAGAAAAAGGATCCGATAAAATTTTGAAGCATTCTCGTCCGAGCCG
ACCAAAACGGCAAGCACAAAAGGAACGAGTTCAACAAAGACGATCAGGAAATATTCAAAA
GCCAGTTGTTCCACAAGGACCATCATTCACAGACGATGATTTCCCACCACTTGGATGATT
GCGAAACCCATTTCAGTTATTTTCTACGTTCTCATTATTGTATGTTATTTATCTAGAAAA
TGCCTATTCAGGTGAAGTGTTAAACTAATATTTTTTAACGTGCCTAATGATAAACACGTG
TTCTTCCAATTAATAATCATCTCATTTTTTTATTTGCGAACTAATCATAAATGTTTCACA
TTAAATAGCCGTATTACGAAAAACGTTCATTGAAACAATTAAAACACAAAAAAGGGGGAA
TTATAATTACGAAATATTATTGTACCGAGTTGGAGCTAGACGGTTGATGTGCAGTCGGAA
TCTTCTTGAGATGGTAACGTCGGAAGAAACTTCCAATGACATGATAAACGATGCAACACG
TTCTTCCTACAGTAACCGAAGCACAGAAATTGCTCTTTGGCTCCGAATGACGAGCACAAT
GGAAATCGGTGCCAGTTTCCCATGGAGAAACACTCTGAATAAATAAAGTAAAAAAAAACA
ATGGAAGTTCATTAAATCCTTACGTCTTCTGCATCAACTTTTTGTCCGAGCAGACTGAAC
CAACGCATGGTTTCTACGTCAATTTTCTCATTCATAATGTCAGAAATAGCTTCCACGAAT
GCTTCAACAATCACAAAACAGTTGGGAGTGACTGGAAAACCTGAAAATGGTACATATTTT
TACATGTCAAGTGCAATAAAGTATATTACCGTATTTCTTCTATTAATATGGCTGCAATAC
TATTTTTCGATGGTCTTCCCGCTTGCAATACTAATAGGGAGTGCAAGACTATTAGGGAGT
GCAATACTAATTTTCAGAACATTTTCTGACTTTGAGCTTACTAGTTTTTTCCTGAAAAAG
CTCGAATCATATTTAAAAATTCAGAAAATTTGATTTTCATATAAGTTCAAAAACTTCAAT
CTCGTAGAAATGATGTGAAAACTGTTGCAAAATAGGCAAAAAATGTTGTTGAAATCCTGA
AATTAGCGAGACGGGTTTGCAATACAAAAAAGTTAACGCAAGACTATTAGAGAGTGCAAG
AATAATAGGGAGTGCAATACTAATTTTCGGAAGGTCTCCGAGGGGCAATACTAATAGGGA
GTGCAAGTCTAATAGGGAGGCCATGTTAATAGAAGATATACGGTATTTACCATCATAATG
AAATCCAACATTATTTGCCAAATGCTTCATGCTGTCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1150, 1201..1653, 1883..2518, 2567..2971, 3019..3478
1058..1150, 1201..1653, 1883..2518, 2567..2971, 3019..3294
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved