Caenorhabditis_elegans Locus ubl-1
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans ubl-1
Caenorhabditis_elegans
ubl-1
III
H06I04.8
1501..1578
2905
TCCATTTGTCCATAACAATTGCACATATATATTTGGTGTTCAGTGGGGATTTTTTTGGA
GAATTTCAGAAGGAAATTTGAAAAAAAAAGCATTCTTTTTCCTTTCCGAAACGGCCAAAA
GTCGGGAAAAAAAGAGCAATTAGGCTCGAGAGCACCCATAAACAATTGCATGAGTTAATT
GAGAATTCGGAGCACGGCGTCGAATCGATTCGAGCTCACTCACGCGAGCGACGGGGAGCA
CAGCACACCACTGAGAATATTACATTTCTCGTTGTCTGGGAGGGTGGCTCGGAGCAATTC
AAGACGACTCGACGCGGGGAAAACCGAAAAACAAGGGACAACATTTTTTCTTCCAGATTT
TTGAGATTATAACTGAAAAAACAAGGGTTTTCGGCACATTTTTTCTGAAAAATTCCCAAA
TTCTAGCTTGAATTTTGAATTTTTTAGTGAATTTTAAACATTTGCCGTGAAAAACCATTC
GGAAATCTTTCCATTTTCAGGTTTTTCACCTTTTTAACCACTGTAAATCTCAATATCCAA
GTGGCTTTTTGTGGAGAAATTGTAAAATTCAATGAAGTTTCATCTGGAATTTGAACGTTT
TCACTCGATTTTTACCATTTTTTCACCAAAAACCACCTGAAACTGGAGCTTTTTCGTTCA
ATTTTCAAATTTTTAACATTTTGTCATCATTTTCCACTTCTGAAACCTGAAAATCTGAAA
ATTCACATCCGAAAACCTCGAAATTCGCTTGAAATTTTTTTTAAGCCGCGCAATTTTAAT
GCAAGCGCGCCCCACCGCACTACTTAGAAGTGCAGGTTATACGGTAGGCGGGGGATTTTA
GGACGACTTTCTCTATTTTTCAACACTTTTTCGATTTTATTCTCGCGTTTTGGCCTAAAT
TTTCTGATTTTTTTTTGGTTTTTGCTGTTAAAATTGATCGATTTTCCTATCTTGTCCAAT
TTTTCTCTATTGAATCCCCTTTTTTCTCTCAATTTATTGTTGTTTTTTGCAGAACTAGGG
TCAGTCAAGCATGGTCTTCGTTAAGACACTCCACAGAACCTTGTTCCTCGAGGTCGCCGC
CAACGAGGATGTCTTGAGCATCAAGCAAAAAATCGAGGCCGCCGAGGGAATTCCAGCCGA
AGAGCAGAGACTCTGCTACGCCGGTTCGTTTCGTTTCACGCAGAATCTCGAGAAGCGATT
TCCTGACACTCGTCGGGTCGCTTTGAGGACAGACCCTGCCGTACACATTCTTGATTTTTA
CCTGTTAAGGACGTCAGCTCGAGGATAGCGATTGCGGAATCGACTCTGAGGCCACCATCT
ACGTCAACCTTGAGCTTCTCGGAGGAGCCAAGAAGAGAAAGAAGAAGGTCTACACCACCC
CAAAGAAGAACAAGAGAAAGCCAAAGAAGGTCAAGCTCGCCGTCCTTAAGTACTACAAGG
TAAGCAGAGTTTCGAATTCGTGAGAAATATCTTGCTCCAGCTCTGCCTAAAAAGTTTGAA
ACGATGATGATGAAGAATTTTTGATATGGTGTCAGGACCTCTGAGAGTTCCGTGATGATG
TTTAGAGTTCCTGAATCTTTTCAAATCTTCTAGGCAGATTAGCAGAGTAGATATTTTCTG
ATAACCAATTTTCATATTTTACTGGCCATTATTATCATATATTTCCAGATCGACGAGAAC
GGCAAGATCACCCGTCTTCGCAAGGAGTGCCAACAACCATCATGCGGAGGAGGAGTCTTC
ATGGCTCAACACGCCAACAGACACTACTGCGGAAGATGCCACGACACCCTCGTCGTTGAC
ACCGCCACTGCCGCTGCCACCTCTGGCGAGAAGGGAGGAAAGAAGGGAAAGAAGTAGACT
GTTGTCCAATTTTTAACCTTCAATCAAAATAAATGTTGATTTTTGATATTCTTGCTATAT
GTTCTTCGGGAGAAAAGTTTATTCGTAACACATCGGAGGAATTATTTGTTTCAGAATTTG
AATATTCTCCAGAAAATAATTAACCAATGACTTAATTATGATGTCATAACTTTGGAAAAA
AACAAGATCTCACGTGTCCGCCTTCTCAAATAGCAAGAGATGCCCGGTCATGACCAGGAT
ACCCTTGAATTGAGGATTGAATTCCCGCCAAATTCCTAGGATTTTTCGTTCAAAATGTCT
TTTCTGAACGCTAAACCTCTCGTTGTTGCATTTTTCGCGTAAAAAGCTAGAAATCGGCCA
AAAGCAGTGAAATTTTGCATAAAGCTGGATATTTGCTCAAAAAGCTAAAAAATCACCTCA
AAAAGCTCAAAATTCCGTTTAAAAAGCTGGTATTTGGCTCAAAATATCCAACATTTCTCT
GAAAAAAGCTGGGAATTAACTTAAAACGCTCAAAAATTCCGCTTTCAAAGCTGAAAATTC
CGCTTAAATTGCTAAAATTCGGCTTTATAAGCTGGAAATTGGCTCGAAAAGCTGAAAATT
CCGCTTAAACTGCTAAAACTCGGCTTCAAAAGCTAGAAATTGGCTTGAAAAGCTCTAAAT
TCCGCTTTAAACGTTGGAAATTCCTCTTAAAAAGAAATTGTCTCAAAAATCTCAAAATTT
CGCTCAAAAAGCTGAAAATTTTGCTTAAAACTTAATTTTTCAAATTAAAATGCTACCCTT
AGGTCCCTTCTTTCCTTTTCTCAAGCATCCACCCATTTTTTATTTTGAAAAATTTGAAAA
AAATTTTAAATTCCTCGCTAAAGTCTATTTTATAAAATAGAAATAGTTATTTTTTCCAAG
AAATTAAAGAATTTCAGACATAAAAACGAGGCTACCCGTTTTCCGCGTAATTTATTTGAG
CAAATTTCTAGCTTTGCTGAGCAAAATTTTCCGATTATAATGCAAAATTGTGAATATTCC
GATTCCAATTCCCGCGCATTAGAATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1162, 1269..1438, 1668..1905
1030..1162, 1269..1438, 1668..1853
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved