Caenorhabditis_elegans Locus Y71D11A.3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y71D11A.3
Caenorhabditis_elegans
Y71D11A.3
III
Y71D11A.7
7043..7115
28464
TTGGAAATTTTTTTTTTGAAATTTTTGTAAATCGGTAAAAAGTTCTAAACAACTATAAA
TTTGAAATCAGCAGCTGACTAACTTAACAATGACCCCCATCATGCCTATATTCCGATCAT
TTTGAGTTTCGACACAGCTGAAACCGGTGCTACAGTACCCCGCGCGGCGGGACCCAATTT
CTCCAATATTGACGGAATATAGGCGTGTAGGGGGTCATTTGGAAGCTAATAACGTACTGA
ATTATATTTTTATAAGCATTTATATATCGATTGAAAATTTGAAAAAAAAAATCAAAAAAT
TAAAAAAAATTAAATTTTTTTTTCCAAAAATTCAAAAAATGTTGTTTGTCGAAATTTTAC
CTACAAGTTTACCTTTCACATTCGGTGCTCCGTGTGTTCCAAAAACTGCAAAAACTGCAA
AAACCACTACAAAAAGAGCTCGAAATTGGCTCATTTCTGGGCGAAAATGATTCCAAAAAA
TGCCAATTTTCTTATCAATACCTGGGTTTTTATCACTTTTTCTACTGATTTTTGATCAAT
TTTATCACATTATCAGTGATTTTGAGCTAACTAGACAGAATTCTAGACAAGGAAATGAAA
AAAAATTGAATTCGAGAAAAAAAAAATTAAAATTTGGAAAAAATTCAAAAAAATTAATTT
TTGGTCCAAAATTTCAAAGTCTTCTAACTTTTTTCATTTTAAAGATTTTCAGTATTTTTT
AGACTCAAAATGTGCAGAATTTTTTTGTTAACATTATGAAGTTACTAAAAACTCACCAAA
TTTTGATCTACAGTACTCCCTTGTACTTTTCGTTGCGGGACTCCAAAAACGACGATTTTC
CAAGTTTCCCCATACATTTTCCACTGTTTTTTTTGGCATTTTTGCATCAAAAACCTCCAA
AAAAGTAATAAATAACCTTTATCACATTGACCATCACCATATCTTATCAGATATCTCTGG
GCAGAAAGGGATAGGCTGCAACATCACGTTTTTTGTTCATTTCTCTGTATTTTCTGTGTT
TTCCTAACTTTACATTTAATTTTTATAATTTTCCTGAATCAAAATGCCGATTTGTGAATT
TTCTGCAAGTAAGTTACTTTTTTGACCCTAAAATTTGAAAATTTCGAGTCAAAAACCGTC
TGTTTGGTATAAACCAATTTATCTCAAAAACTGACAGTTTTTTTCAAAAAATAGTCAACT
AAGAAATTGTAGCCCTTAAAATTCTACACATTTTCATAATTAAAAGTTTTTTGATAGCTC
TCCTCTCCGCGGAGTTATGCGTTTTTAAAGTCCAGAGTGCTCTCTAGCCACGGGCGACGG
GGAGAGACGCAGACGGCGGTGGCAGTCAGTGGGGAGAGAGCATGCCGAATCTTTAAAGGC
GCATAACTCCGCGGGATGCAGAGCTATCAAAAAACTTTTAATTAACAAAATGTGTAGAAT
TTTTTGCTTTAAAATTTGCTAGTTAAAAATTTTTCGATAGCACCGCCAGATTTTGAGATA
CAGCAGCTTCAACTTTTGTACTAATTTTAGCCTCAAAATCGCGGAAAATTGATGTCCACG
CTCATGTTTTGCCAAAAAACATCCCGGATTTTCAAGAGGTAAATTACTTTTTTTAAGTTT
GTGTTTTGAGAAAAAATTAGAAAAAACTCCCAAAAAAAATTTGTCAAAAAAAATTCCAAA
AAAAAAAATTCAGAAATTCGGGTACCCCGGCTTCGTCCGGCTGGACCATAAGGAAGATGG
TACTACGCATATGGTGAAGGACGGAAAACTGTTCAGGTTTTCCCTAGGAAGCTTAATTTT
TTTTTGGGAAAAAATATATTTCCAGAGTCGTGGAGCCCAACTGCTTCGATACAGAGACTA
GAATTGCGGATATGAATCGGGCAAATGTGAATGTACAGTGTCTGAGTACGGTACCTGTAA
TGTTTAGCTATTGGGTAGGTTTTGGCGGAAATTTGAAATTTTTGAAAAATTAAAAAAAAA
AATTTGAAAGTTTTTTCAAAAATTTTTGGATTTTTTAAAATGAAGTTTCATCAATTCTAG
TTTTAATTTTCTAGTTCTCCTCATTATGAGCTTTCAAATGACCCCCATCACGCCCCTATT
CCGACAACTTTGAAATATTGGGTCCCGCCACGCGGGGTACTGTAGCACTGGCTTCAGCTG
TGGCGAAAATCAAAACGGGCGGAAACTAGCTGTGTAGGGTGTTATTTTAATTCTGAGAAT
GTGAAAAATTCAATTTTTGCAGTAAAAATTATTCAGAATTCATGCCTTTAAAAATTAAGA
TTTTTTTTTGAAAATTAAAAAAAATTTCAAAAATTTTTGAAATTTTTTAAAAATGAAGTT
TCATCAATTATAACTTCAATTTTCACGTTCTTCTCATTTTTAGCTTATAAATAACACCCA
TCATGCCCTAATTCCGTCTATTTTGAATTTTCGGGTTCCACCACGCTGGTTACTGTAGCA
TTGGCTTCAGCTGTGCCGAAACTCAAATTTCACGGAACCTAGGCAAGATGGGTGTTATTT
TGAAGCTAAGAACATGATGAACTTGAATTTTGCCGAAAAAACGGCAAAAACTCATTAATT
ACGGAGAAATTTAATTTTCGAAAAAATTCAATATAAAAATTTGAACTTTTAAAATTTTTC
TGCCTCCTTCCTAAAACCCCCATCTTGCCACACACACGCGTTTTCGATGTTCAAAAAATG
TTCAAAAAATGTCCGAAAAAATGTAATACAACTTTGAACGTTTATATCTCGGCTCTCACG
GAACCGATTTTTGAAATTCTTTTTTCTCTACATTCACAAAATATAGCGACGTGTGTTCAT
CTAAAAGGGGGTTGATTTTGGAGCATCCTGTCGGCTCCACAAGCGGAAAACCACACCCCG
CTTGTTTTTGCGCACACCGAAGTACTGGCCGAAAACCACTTTAAATTGAAGGAAAATTCG
AGTTTATGTTCAAAACGTTTGAGACTCGAAACTTAAGTTCTCCTTTTCAATGCCTATCCA
CTGTATCTAAGTTCATTGTGATATCTCTATTCGTTATTTTAAAAACGATAATTAAAGTTT
TGCCAAAATTTCTGCATCTCCCACCTTTTCTCACACACACACACACCCCCCCCCCTTTCA
TATTTGGTGTGTTTTCGGCCACATTTTCACCATTGTTTCGATCAAATCTCCGTTAGTCTT
GTTTTTTTTCCAAATTTTTTTTTGGAAAAATGTTCATCACATCGAGAGGAAGCGGAAAAT
ATAATTTTTTGTTTCAAAAAAGGTAAATAATAGTCTCAAAAATAGAAAAAATGAACACTT
CTTTCAAACAATTTACATTTTTCCATCAAATTCACAAACTTTCCACTATCGTTCCGGTTT
TTATGTTAAATTTAGAATTAATAGAATGATTTAAAATGAAATCTCAAATCACAGCTCGAT
CCGATCATTTTTCGCAGAGATAGGGTATTTAATTTTTGCACATGGAAATCCAGTTTTCCT
CTGTTCCTAAACAAGTTTTCAACTATCCTTTTGATTTTATGTTTTAATTTTGATAATTTT
CACTAAAGAAAGGTAGACAATCTAAATTTGGTCGGTCTTGACAACTTTCAGCACATTTGT
GGAAGTTTTGAGCTTCCAGGCCTTCCCAGAAGGTGATATGTTTCAATTTTTGTTATTTTT
AGAAATAATAACCGCCGTATTATTGTACTTTTTACGCCAATTTCAAAAATTATTTAATTT
TTCTCAAACTTCTACTATGAGCAAAGTTATGACGGATTGAAGTTTTAGTGCATTACTCCT
CACAGGTCGCCTCTACTCACAAGAGGCTGCATGCGTGCGGGTGGCTGGAAAATGTTTTCT
TTCCAAAAAAAAACGTAGAAAGGCACTTTAGCCTAAGAAGAAGTTCACTTTGAACATATA
CTTCAGGCATTGCAGGCCGGAGGCCTGCTGTGCGATTACAACTGTTTTAAGCCCAGATTG
GCTGGATTAAGTGCCGCAGGCACTCTTACTCTTAGAAGACGCAGTCAACCTTAAATCATT
ATACCAAGGCAGACCGGAGGCCTAATATGCAATTACTCTTAGATAAGTTTGATTTAGAAA
GCTTTTATTATTTTCAGTTTTCTAAAACAATCCCCATTCCCGAAGGGCTGCGGGGCCCAC
AGGCGTTCACGATTTTCCAAAAAGTAGATATGTTATTCACTCGAACCAACCAGGTTTGAG
GGCCGCAGGCCCGAACACTCTTGGAAACTTTGGGCTGGCTTTGATCCTATTCTAAGCAGA
TATGTTATTTACTCAAACCTAACAACCAGGTTCGAGGGCCGCAGGCCCGAACACTCTTGG
AAACTATGGGCTGGCTTTGATCCTATTCTAAGCAGATATGTTATTCACTCAAGCCTAATA
ACCAGGTTTGAGGGCCGCAGGCCCAAATACTCTTGAAAACTGTGGGCTGGCTTTAATCCT
ATTCTTAGCAGAGTAGGCTGTAGGCCTGCGACGCGGTTGTTATTTACTCAAACCTAACAA
CCAGGTTCGAGGGCCGCAGGCCCGAACACTCTTGGAAACTATGGGCTGGCTTTGATCCTA
TTCTAAGCAGATATGTTATTCACTCAAGCCTAATAACCAGGTTAGAGGGCCGCAGGCCCG
AATACTCTTGAAAACTGTGGGCTGGCTTTAATCCTATTCCAAGCAGAGCAGGCCGTATTC
ATGAGTTTTCCTTTTCATTCACCGTTTTTTGTAGTTCACAGTGATGATTGAAAACACGCT
TATTTTATTGAATACATTCAAATTATTCTTGAACAAAATCTCAGCCTAAGTTATTCGTAC
AGTGTCGGTCCTGGAGCAATGAATCAAATAATTTCAAAAATAATTTCAAAGAGATCGCGA
ATAACCCGTTAACAGGTTCGAGGCGAAGCCGAGAACCTGCGCCAGCTACCTTGCTAATAA
CTTAGAGCGAATTAACCCTATCCCCATTCCCGAAGGGCTGGCGGGCCCATAGGCCCGCTA
GTCCGTAGTTTTCTAAAAATGAATTTTAACTTTTTACGTGTATTTTTCTGAATTTTTCAT
TTTTTACCTTCAAAATGACGCCCATCATGCTTAGATTCCGTCAATTCTGAAAATTTGGGT
CCCGTCACTCGGGGTACTGTAGCACTGGCTTCAGCTGTGTCGAAACTCAAAATGGCCGGA
ATATATGGCAATCTATCCCATGCTCACATTTCCCATGCACACATTTCCCATGCTGACACT
TTCTCCCGTGCATACAAAATTCCCATGCTTACGCCCAGTAGTTGGAGTACTCCCATGCCT
ACAATTAATTTTTCTCCTTTTTTTCCGTTCCCATGCTGACGTTCCCATACATACATTTTC
TCCCGTGCATACAAAATATTCTGATGCTTACATCCAGTAGTCGAAGTACTCCTGTGCCTA
CAACTCATTTTTCCCTTTTTTTTCGTTCCCATGCTGACATTCCCATACATACATTTTCTC
CCGTGCATACAAAATTCCCATGCTTACATCCAGTAGTCGAACGTCTTACTTGACAGCTTT
CAGTTACAACTGATCGCTTTTTTTTTCAAAATGCATTAGTTCTCGATTATGAACAATGAA
TCGAAGAAAAATGGGGATGACTGCCTATAGAGTAAAATTTTTTTTTGCTCAAAAAAAAAT
TTTTTTTTTTAATTTTTTTCTCTCTATTTCGTAGGATATAATTAATTCGGTGAATTCCAC
AACTTCAAATGTTCATATTGCTGTTTCCGTGCAGTTATGAGTTTCGCAGTGTCTTAGGAA
CATTCCATTTTTTGTTGCATTTTGTAGGAATTCGGAGCTATCTTATAATTTCTACAAATT
AGAAAATCCATTTCGCATTATTTCATGTAACTTGAACCTATTGCTTCAAAAATAGCACAG
AACGAATGTTTATTTATACAAAATGGTCCCGTCATTGGTCTCGCCAGCGCTCAACAAATC
AATGGGATGCGCGTGGCGAGATTATTGCGCGAAAATTCGCGCGCCTTTAAAGTCGTAGAA
GTGGGAAAAAATGCACAGTAGCACATTTTTTAATGAAAGAAACAGAATCAACATTCGTTC
TGTGCTATTTTTGAAGCAATAGGTTCAAGTTACATGAAATAATGCGAAATGGATTTTCTA
ATTTGTAGAAATTATAAGATAGCTCCGAATTCCTACAAAATGCAACAAAAAATGGAATGT
TCCTAAGACACTGCGAAACTCATAACTGCACGGAAACAGCAATATGAACATTTGAAGTTG
TGGAATTCACCGAATTAATTATATCCTACAAAATAGAGAGAAAAAAATTAAAAAAAAAAA
ATTTTTTTTTGAGCAAAAAAAAATTTTACTCTATAGGCAGTCATCCCCATTTTTCTTCGA
TTCCTTGTTCATAATCGAGAACTAATGCATTTTGAAAAAAAAAGCGATCAGTTGTAACTG
AAAGCTGTCAAGTAAGCCTAATACAATGAAAATGAGCAAAAAAATTGACTTTGTGCTCTT
CTGGAGCACAAAACTGTTCCATGTCGGCATGGGAATACATTTTTGTAAGTATGGGAACAA
ATGTATGTATGGGAATGTCAGCATAGGAACGAAAAAAAATGGAAAAAATGAGGTGTATGC
ATAGGAGTACTTCGACTACTGGATGTAAGCATGGGAATTTTGTATGCACCGGAAAAAATG
TATGTATGAGAATGTCAGCATGGGAACGGAAAAAAGGGAAAAAATGAGTTGTAGGCATGG
GAGTACTCGAACTACTGGGCGTAGCATGGGAATATTTTGTATGCACGGGAGAGTGTCAGC
ATGGGAAATGTGTGCATGGGAAATGTGAGCATGGGATAGATTGCCGGAATATATGCATGT
TGGGTGTTATTTTGAAGCTAAAAACAAGTAGAACTTGATTTTCACAAAGAAAATAATTTT
TCTCTAACCCTGCATCTCTCTCCCGTCCCGTCCTTATCTTCATATACGGCAAACCATTCG
ACCCGCCGCTGTTGCCGTTTAGCGCAGGCGGGAGTGGCACGGGTTGGGGTTCTAAAGGCC
GCTGGTTCGTGCCCCGACCAGTTAAAAAGTCAATGATGTTTTTTCAAGACGGGACCGACT
GGTGAATGATGCATAAATGAAATGCTGAGACTTTTTTTTGCATTAAAAAAAGTTTTTTTG
GACTAAAATTTTATCGATTTCTTTTTGTATAAAGTTTTTTTTTAGGCTAAACCTGCTGAC
ACCGAAATTGTGGCCCGCTTCGTCAACGATGATTTGTTGGCAGAGTGCCAAAAATTCCCA
GATCGGCTTGTGCCGCTTGGCACCCTGCCAATGAATGATGTGCAGAGAGCTGTAGAAGTA
AGTAGTAGATTTTTGATAATTTATTGATTTTTAGAGCAGAAAAAAGTTTTGAAACATTTC
GAAAAAAAAATGTTTTTTTGGGTAATTTTTCAAAAATGAAGTTTCATCAATTATATCAGG
TTGTCCCATAAGTTTTTGTACTATTTTTTTTTTGAAAAAAATTTATTTCTCTCAAGCGAC
AAGTAGTACTATTCACACAAGTATTCACCATTAGACCACTTGTTGCCATTTACTAGGTAA
CATCATGATGCCACGGGAGAAGAAATCCGGCGAACGCGATGAGAAGAAAGTGGAGAGTTC
AGTTTTGAGATGCTCTTCGTCGTCGAATTGCTTGTCGCGCATGTAGTCACTGAGAGACAA
GAACAAATGGTAGTCGGTTGGTGCAAGATCTGGAGAATATGGTGGATGCGGTAAAACAGT
CCAACCAAGATCTTGCAGCTTTTGGAAAGTCTTCTTGGCGACATGAGGCCTAGCATTATC
GTGAAGAAAATATAGTTTTTCATATTTTCCGTTGGTCTTTTCTGCAACTCGGTCCAATTG
GGCACAATAGTAATCAGCAGTGATAGTTTTATTAGTTGGCAACAATTCCCAGTGCACGGG
TCCTTGAACGCCCCACCAGACACAGATCATAATCTTTTTTGGGTGAAGATCAGGCTTTGG
CGTCGGTATTCCTTTCTCACCGATCGGAAGCCATTGACGTTTTCTGGAATGGTTAACATA
GAGCACCCACTTCTCATCTCCAGTAACCAGATTGTTCAGCCAATCGAACTTTCGACGAAA
AGTTAGAAGTTGAGTACAAACGTTGACCCGAGTGAGCTTCTGTGATGCCGAAAGTTCATG
AGGCACCCAAGTTCCAAGTTTTGAAGTAAAACCAAGGCGACCCAAGTGACGTGCAATTGT
GCTATGACAACACTCAAGCTTCTCTTCCATTTCACGAAGACTAAGACGAGGCTCTTCCTC
CACCAGCTTCACTAGGTCTTCTTCATTTAACTCTACCGGTCGCCCAGAACGTTCTATTTC
TTCGAGACTGAAGTCGCCGTTCTTGAACTTTTGAAACCAACTCTTTGCTGTATTATAAGA
GAGTGCTCCCTCACCTATCGCACCGCATATGTTTCGTTCCGCTTCCATTGCTGAATGACC
AAGACGAAATTCATAAAGAAGAAGCAATCTAACGTCTCGACGTTCAAGTTTGATGATTGT
CATCGTGGCAAAGTAGAAATGGATGAAATGAATCTTTTCTGAAAGGGGACGACCCGACCT
TGACACGACCTACGATGAAAAAATTTTAAAACTTTCTAGAAGTTTTGGAAAAATATTTGA
AAAAAAGTACAAAAACTTATGGGACAACCTGATAACTTCAATTTTTAGTTCTCCTCATTT
TTAGCTTTGAAACAACACCCATCATGCCTAGGTTCGGGCGATTTAGAATTTTTTGGGTCC
CGCCACTCGGGGTACTGTAGCACTGGCCTCAGCTGTGTCGACACTCGAATTGCACGGAAT
ATGGGCATGATGGGTGTCATTTGAAAGCTAAGAACATGGTGAAACTAATTTTCGCAAAGA
AAACTAACGAAAATCAATATTTAAAAAAATTCAAAAAAAAAAGTTTGAAAAAAAATCCTT
AAATTCTTGCAAATTTTTTTTAACTTTTGTAAACTGTCGTAAATAAATATAGATTTTGAT
TTCAGCTAGTCATGAGCTTTTAATTGACCCCCATCAAGCCTAGATTCCGTCAATTTTGAA
AGTTTGGGTCCCGCCACGCGGGGTACTGTAGCACTGGCTTCAGCTGTGTCGACACTCGAA
TTGCACGGAATATGAGCATGATGGGTGTCATTTGAAAGCTAAGAACATGGTGAAACTGAT
TTTCGCAAGGAAAACTAACGAAAATCAATATTTAAAAAAATTCAAAAAAAAAAGTTTGAA
CAAAAATCCTTAAATTCTTGCAAATTTTTTTAACTTTTGTAAACTGTCGTAAATAAATAT
AATTTTTGATTTTAACTAGTCATGAGCTTTCAAATGACCCCCATCAAGCCTCCATTCCGT
CAATTTTGAAAGTTTGGGTCCTGCCACGCGGGGTACTGTAGCACTGGCCTCAGCTGTGTC
GACACTCGAATTGCACGGAATATGGGCATTATGGGTGTCATTTGAAAGCTAAGAACATGG
TGAAACTGATTTTCGCAAAGAAAACTAACGAAAATCAATATTTTAAAAAAATTTTAAAAG
TTTGAAAAAAAATCCTTAAATTCTTGCAAATTTTTTTTTAACTTTTGTAAGCTGTAGTAA
ATAAATATAATTTTTGATTTTAACTAGTCATGAGCTTTCAAATGACCCCCATCAAGCCTA
GATTCCATTAATTTTGAGAGTGTGGGTCCCGCTACGCGGGGTATTGTAGCACCGGCTTCA
GCTGTGTCGACACTCAAACTTTTGTTAAAAATGTTATTCCCAGAACAAATTATCATAAAT
ATTATATTTATTATACATTCGTTGACTAGAAAAAATAAAATTTCGAAAAAAAACTGAGAA
AATTCTGAGCAAAGTTCAAAAAGTGGGCGTGGTCCAAATAAATAGTATTATTGATTTTTA
ACACAAAAGTGTTACCAAAATCCCGTTGTAAAATCAAAAATCAATATTTTATCAAAAAAT
TAAGAGCGGAAAGTGAAAATCGATAATTTTCGAGGAAAATATTTTTTTTGGAAAAAAAAA
TTTTTTCCAAAAAAATTGTTTCTTGAAAATTCTCAAAAAACCCGTTCATTAAAAAATCAA
TAAATTAATCAATAAAGAGGTCATTAATAGCCCCGTAGATAGTGTTGCCAGTAGGCAATA
TTGAAGAGTACGAACAGGAAGGGGAACATGAAAACGGACACCGAATCGATTTTGTGAGCA
AGTATTTCGCGGCGTTGTTTTCTGAAAAATTGGATATTTATTGATTATTAATTGATAATA
CGAGAAAATATCGATTTTTGAGAAAAAAATTTTTCAAAATTTTTTTCAATTTCAAAAAAA
TCGATAATATTGATTTTTCCAAACTTACCGTGATAAAGAAGATGACGTGGATGTGGGTAT
TGTCTCTGCTTCGTCTAGCATCAAATTGACAACATTTGTGGGCTCACAGGAGCATCTGAA
AAAATTTGAAATTTTGGAAAAAAAATTTTGTTGGTTTTTTTTTTCAATTCTCAATTAAAC
CCATTTTCAGTACAAAATTCGTATTCAGCACGTTTAGAACTTCAAAATGACCCCCATCAT
GCCTAGATTCCGTCAATGTTCGAAAATTTGGGTCTCGCCACGCGGGGTACTGTAGCACCA
GTTTCAGCTGTGTCGGAGTTGAAATTGGCACCTAGGCATGTTGGGTGTCATTTTGAAGCT
AAGAGGGTAACAAAATCAAATTCTGTATTTGTTTCTGACAAAAATCGATAATTTCTCAAA
TTCTAATAAATTTCAAAAATTGAAACTTGGAAAGAATAGTATTAGATTTATTTGTCTTAT
TTTTGATTTTTCAGGATTTTAGAACAAAAATTCGAATTTAGCAAGTCGATAGCTTTCAAA
TGACCCCCATCATGCCTATATTCCGTCACTTTTTGAAAATTTGGGTCCCGCCACGCTGGG
TACTGTAGCACCAGTTTCAGCTGTGTCGGAATCGAAAATCGGTGGAACCTAGTCATGATG
GGTTTTATTTTGAAGCTGAGTGCACGGCAAAATCGAATTTTGTATTAATTTTTAACGAAA
AACTATAATTTCTCAATTTCTAATAAATTTATAAAATTGAAACTGAAAAAAAAAGTTTTG
GATTTATTTTTATTATTTTTGATTTTTCAGGATTTTAAAGCAAAAATTTGAATTCAGCAT
GTCCGTAGCTTTCAAATGACCTCCATCATGTCTAGATTCCGTCAATTTTCGAAAATTTGG
GTCTCGCCACGCGGGGTACTGTCGCACCAGTTTCAGCTGTGTCGAAACTCAAAGTCGTCG
AAAACTAGGCTTGTTGGGGGTCATTTTGAAGCTGAGAGCATAACAAAATCGAATTCTGTA
TTAGTTTCTGGCAAAATACAGTGCTTTTTAAATTTTTAATAAATTTCCATTTTCAAAAAT
TGAAATTTTAAAAAGTATTAAAAAAAATTTCTTTTGAATTTTTTAAATTTTTTGAAAATC
AAACTCACGAAGAACTGAAACTCTTCATAGCATTTGCCACATTGCCATTAAGCCCAAATC
CCGGTGGAATATACCCATAATCATTGTCCCGCAAGCTCAAAAGAGCACTCTCCTCCTCAT
TTTTCGGCTGCTTCTGCCTCCGGTGCACCGATGAGTTGTTGGCATTCTGTTGTACTGGCG
GTGGATGACAAGGTTTTGGAGCCACCTGAGCCGATGGTTGGAGACATTTTGCGCTTGTTG
GCTCCTCTTCCCGGGAGAGGTAGCCGACCCAGGCGAGTTCTAGCAGGGAGCAGAACACAA
ATGTCATGCAGGACAGCATCCATACATCGATAGCCTAAAATTGATTTGAGATTTAAAAAG
AGTACATAATTTGGAGCAGTTTATCAGTTGACAAAATTTTTATAGCTTTGAATATAAAAA
AGTTACAAGAGGAAGAGATTTTTTTTTAGAATTTTAACTTTAAACTCAAATATCTAAAAA
ACTAGCAGAATTAAAAAAAAATTGTCAACTAACAAATTGTAGCCCTTGAAATTCTAAACA
TTTTAGTAATTTAAAGTTTTTTGCTAGCTGATTTACCCGCGAAGTTATGCGCGTTCAAAG
TTTCCCACAGACTATGGTGTGTCGGCGCCTGCGTCTCTCCTCCGAGAGAGCGCGTGCGCA
AACTTTAAAAGCGCATAACTCTGCGGGGAGTCGCCGTATTGAAAATTTTTGAACTGATGA
AATATTCAAAATTTTAAGGGCTACAAATTTGCAGTTGAAAATTTTTTGATAACTCCCACG
AATTTCTAGATAAACTCACTTTTACATAAGAAACCCTCGGCAGATTCCTGATAATGTTAC
CAAACTGGAAAGTCATTGCAAGTAAGCTGTTAACTCCCAACATGGTACGTGCCGGAATAG
CTTTGGAGCCAAGTGCGAAGGAAATCCAGGCTGAAAAAATTTTTTAAAAAATTTGGAAAA
AAAATCGGGAAAATTTTTTTTTGGAAACTTTTTTCAATTTTTTTTCGCAATTTACTGCTT
AAATTGAGCCCTATAATATTGAATTTTGCTGGAAAAATTTTTATTGCTCAATTTCCTTAC
ATTTAGGCTTTTCGTTGTGAGAATAACACTCAAATTGGCACCATTATTAGCTTCGTTTTG
AAATTTCTTATTTGTTCTAATGAGTTTGTACGTGGAAGTACGTGCAAAACTTTAATTAGA
AAAATTGAACTATACTGAGTTTTTAAAAATTCAAAAAAAAGGTTTTAAAATTTCAAAAAA
AATTTTTTTTGAATTTTTTATTTTTTCGTAAATTTTCTTAAATATCTATTTTTATTAGTT
TTCATTACGAAATATGAATTTTCTACGTTTTTAGCTTTAAAATGACCCCCATCATGCCTA
GGTTTGGAGCACCTTTGCTTCCGGCACAGCTGACGCCAGTGCTCCAGTACCCCGCGTGGC
GAGACCCTAATTTTCTAAAATTGACGGAATCTAGGCATGATGGGGATCATTCAAAAGTTC
ATGAAAAGTTGAATTCAAATATTATGCTCATTTACTCAAAATTTTCAAAACTAAAAAAAA
ATTGCAAGAATTTCATGAAATTTTTTTTTCCATAAAAAAAGTTTTCGAATTTTCTCAAAA
GTTGATTTTCGTTAGTTTTCATTGCGAAAATTAAGTTTTTAACGTTTTCAGCTTTCGAAT
GACCCCCCATCATGCCTAGGTTTGGAGCACCTTTTCTCCCGGCACAGCTGACGCCAGTGC
TACAGTACCCCGCGTAGCGAGACCCAAATTTTCAAAGTTTACGGAGTATAGGCATGATGG
TGGTCATTTGAAAGCTCATGAAGAGCTTAAATCAAATATTATATTCATTTATCGACATTT
TTGAGATTGAAAAAAAATTAGCAAGAATTTCAAAATTTTTGTTCAAAAAAAAATTTTTTT
TTTGGATTTTTTTGTTTTTGTTTCCAAAAAAACTTACATATACAAATAGTTAGATACGTA
GGTAAATACGCCTGCAAAATATACCATCCCGCTCGTCTTTTGAACTCGAATGACATTGTC
AGCTCGTGCCAGTACCCAGCGGGATATTCCTGGAATTTTTTCCATTTTTTGAGTGGAAGT
AGATCAAAAACTTAACTGTTATGCATTTTATCATAAAATTCACAATTAGTTGAATATTTT
TCAACAAAAATTTGCTAAAAAATCTTAAAAATTGACAAAGTTAGGATGTTTTGAAAGTTT
TGAAATTTAAAATTTTTTCCAAAAAAAAAAAATTTTTCAAATATTTAAAAAAAACTCCCC
TGAACTCAAATTTTCTGAAATTTTCAGTTTTTATATCAATTTCTCACCTCCGTTGTTCGT
ATTTTGTGTATATCCACCAGCTCATAGTCCGCTAATTCCATTTTATCCCTCATTTTCTGG
ACCCCGTTCACCGACCAGTCCATCTTCACCTCGTCTGTATTGTAGCTGAAAATTAGGGAA
ATTTTGGCTGGAATAGTGTAAATATTTGGGTTCTTGAATTTACGTTAAAAGTAAAAAAAA
AACTTTCGAAAAAAAAAAAATTTTTGAATTTTTTTCAAAAAATTTCTGAAATTTTTTATC
TAGTTTTTTTTTGCAGTTTTTAATTTATAAATTTGCATTTTTCAGTTTACTAGTTTCAAA
ATAACCCCCATCATGCCTAGAATCCATTAACTTTGAAAATTTGGGTCTCGCCACGCTGGG
TACTGTAGCACCAACTTCAGCTGTGTCGATAATCAAAATCAAGGGAATATAGGCAAGACG
GGTGTTATTTGGAAGCCCAGAACGTGAAAAACTCGATTTATAAGATAGGAACTGTAGAAA
ATGAAGTCTAATTTTTTTTTGGGAATTTAGAAAATTTACCAAAATTTTTTTTTTGATTTT
TTGAATTAAAATCAAGAAACTTACTTAAAACTTTCAAAAGTCAGCGAACACGTCACATTG
TCAAATGGAAACTTCGTCAGATCCATAATACATGGCCCTTGAAGTTTCAGACGGTAGTTT
GTCCAAACTGAAAAAACCAATTTAGAAATTCAGAAAAAAATTAAATTCTTTAAAAAAAAA
ATAAATTCTTTTTTAATTTCTCAATATTACAAGTAATAAATTCACTTTTTAGAGTTCACC
AGCTTCAAAATGACCCCCATATTGCCTATATTACGTCAACTTTGATAGTTTGGGTCTCGC
CACGCGGGGTACTGTAGCACCAGTTTCAGCTGTGTCGAAAATTAGGACATCACCGGTTTT
GCTCCATTTGTCCGATATTTTGAGTTTTTCTTATGAAATCATCTCCAATTTCGTTTATTT
TTATTCTCGACACAGCTGAAACCGGTGCTACAGTACCCCCCGTGGCGAGACCCAAAATTT
CAAAAACGACGGAATATAGGCTTGTAGGGGGTCAATTGAAAGGTCACAACGTGCTGAAAT
CAAATTTGTTAATGCAATTTTTTTTTCGGCAAGTTTTGGCTTAAAATGTATGTAACTACA
GTACCCACAGAGAACTTCGTGGTGGGACCCAACATTTTTTAAATTTAATTTTTTTGTTGT
AAACCCCCGATATTTTCAATCTAAATTGTGCGTTCTCCTTCTCCTTCTTTTTTTTTAGTT
TTCCAATCTAAACTCATCACGCAAATGTTCCGCGAGCATCTTTTTTTACTGCGCCGCAAT
TTTCTCGAGATAGCCTTTAAATCGTGACTTTTTCACGATAAACCAATGAATTATTCCGGT
TGGGGGAAGAGATTAAGTCTATAGATTTGGAAAAAAAAGAAAAAAAAAAGAATTTTAATT
GTTTTAGAGAGGATTTTCGAAAAAAAAATAGAAAATAAAATTTATCCTTAAAAAAAAATT
TTTCTTTTGAACTTTTTCAAGTTTACAGATTTTTCCATAATTTTTTGTGTAATATTTAAA
TAAATAATCACAAAATTTTTAAAAAATTTAAAAATCCCTAAAAGTCCTAAATGTACAGTA
ATCCAAGACTTTTTTTTTCTGACAAGGCTCAAAATTTTTTTTTTAATTTTTGACACATTT
TCAAAAATTCATAACTTTTTCAATTTTAGAGATTTTTCCATATTTTTTTGTGTACTATTT
GGGTTAATAAATATAAAATTTAAAAAAAAATTACCAAAAACTCTGAACGTCCTAAATGTA
CCGTAACACAAGGCTTTTTCTCACGAGCTCAAAATTTTGAATTTTTTTTCAAATTTTCAA
AAATTCATAACTTTTTAAATTTTAGATATTTTTCCCTAATTTTTTGTGTAATACTTTAAT
AAACAATTCATAATTTTTTTAAAACATACCAAAATCTTTAAAACATTAAATCTACAGTAG
CTGAAGACTTTTTCTGACAGGGATCAAAAAAAAATTCAAATATTTTTTTTTTCAAATTTT
CAAAAATTCATAACTTTTTCAATTTTACATATTGTTTCATAATTTTTTGTGTAATAGTTT
GATAAATAAATATAAAACTTTAGAAAAATATCAAAAACTCTAAAAGACAAAAAATTTCGG
AATTTTTTTAAAAATTTTTTTTTTAACTTTGAAAACTTTTTTTAAATCTTCGTGTTTCAA
ATTTCAAACTATTTTTTAATATTTATAGTACATTTGCAATACATTTTACGCCTTGAAACC
ACGTTTTCACCAAGTTTGATTCAATTTTCAATTTTCCAGTGGCCAAATTTCCAACTAAAC
TCTTTCCCTCAGTGAAAAAAGTGTTTTTTCGGAAACTTTTCCCGGAAAACGTGACAAAAA
AATTTCAAACAATTTTGTGTCCCCAAAAACTATCAAATTTGCATGTTTCCCAGCCGCCGT
GGCCCAATAGTGAAAATAAACAGGAACTATTGGGGGGACCCGCGCGCGCGGGCCCCGTAA
TCGAATTGTCCGGTTTTGGGGTCATGTGGGACCCCCGAAGCTAGCGGATTTTTGGTTTTT
ATAGTGATGTCAGTTTCTTAGAGTACAACACATTTTACTGGTCTGGCGAAAAATTTGAAA
AAAAACTCGAATAAAATTTTTTTCTCAAAAATTGGGTACCGTCGGGAAAAGTCATGGGGT
ACGGATTTTTTAGAATTTTTCTCACATGTTCTTAACATCATCATTTGAACAAGGTTTAAA
CACAAATTTTAATTTTAAAATTAGGAAGAAATCTCAAAAATTGGCAAAGTTACAAGGTTT
TGAAAATAAATTTTAAAAACTCAGATATTTTTTTTCTCAAAAATTGGGTCCCGTCGGGAT
AAGTCATGGGAAACAAAGTTTTTGAAATTTTTTAAACATTTTGTTAAAATTATTATATTG
ACAAATTTTGAGCACATATTTTAAAACAAAAATGGGCAAAAAATCTTGAAAACTGACAAA
GTTACGAGGTTTGGAAAATTTCAGAAAAATTTTTTTAAAATTTATTTTGAAATTTTGGAT
CTCGTCAGGAAAAGTCATGGGAAACGGATTTCTTGAAATTTTTTGTACATTTTGTTAAAA
TTTTCATATTAATATGTTTCCAACACACATTTTAATACAAAAATGAGCAAAAGATCTTGA
AAATTGAAAAAAGTTACGAGGTTTTGAAATTGGAAAAAAATTTAAAAAAAAAATTTTTTT
GAAAATTTGGGTCCCGTCAGGAAAAGTCTTGGGGTACGGTTTTTGTGATTTTTCACAAAT
TGCTACTTTGTTAACTTTGATAAGGTTTTTTCACACAATTCAAGGTAAAAATGATGAAAT
TTTCTCAAAAACTGACAAAGTTACGAGATTCTGAAAATCACTTAAATTGTTTTGGAAAAA
ATTTTTTGGATCTCGCCAGGAAAAGGCTTGGGAAACGGAGTTTTTGAATTTTTCAAACAT
TTTCGTTTTAATCATCATATTAATAAGGTTTTAACACACATTTTAAAATAAAAATTAGCA
AAAAATCTTAAAAACTGACAAAGTTACGAGATTCTGAAATTCACTGAAATTTTTTTTGGA
AATTTTTGAGTCCGGGCAGGAAAAGTCATGGGAAACGGAGTTTTTGAATTGTTAAGTTTT
TGCGTTTTAATTATCATATTAATAAGGCTCTAACACACATTTGAAAATAAAAATCAGCAA
AAACTCGAACATTGACAAAGTTATGAGGTTTTGAAATTTTTGGTCCAAATTTTTATTAAT
AAATTTTTTTTTCAACGCAGTATTTTTTCGCCATTTCCAATTTAATCCCCACATTTTTCG
GAACGGCCTGGTGATTTATAGTCAGAAGCTATTGATCCCTCCAAAAAAAAGAGCAAAAAG
AGCCCCCGAAAAGTGCAGCGGCACAAAACTTTTTTCACCCCACTTTTTTACTGGGGGTCC
TCTAAGACACCACTAAAATCTTTGCTTTTTGCACACCATTTTTATCTATTCGCCAGCTCC
CTTGGGGGCTCCGTGAGCCGTCTTGCTAGAGTACTATAAAGCTCACGGAGAGCAGGAATT
GAAAAAAAATTTGGAGAAAAAAATTAATTTTAATTTTCGAACTCAGCAACGCATTAGCTT
TCAAATAACACCCATCATGCCTACACTCCGTCCAATTCAAAAGTTTGAGTACACCGACAC
AGCTGAAACCGGTGCTACAGTACCCCGCGTGGCGAGACCCAAAATTTCGAAAATCATCAG
AACCTAGGCATATGGGTGTTGTTTTGAAGGTCTCGACACGATAAAATGAGTAAAACAAAT
GTTGAAATTTAAAATTCAAGTTCATTCGGAACATTTCAGATTTTTCCACCCTAAAAAATT
CGAAAAAAAAACATTTTCCAAAAAAAAATTTTTTTTTGAATTTTTAAATTTTCAAATTTT
CAAAAATTCATAACTTAATCAATTTTTGTGCAAAATTTGAAATTATTAGCTTAAATTGTG
CGCAAAATATTATTTTAAATGAATAAATTTGAAAATCTTATCAAAATTCTATTTAAAACA
ACGGAACCCCGTAAATTTTCGTGGCGGGGATTCAAAAATTCAAAAAAAAAATTTTTTTTA
AAGAATTTTCAAAAATTCATAATTTTATCAATATAAGGGCTATTTTGTTCACTTTTAACT
TAAATGTGCATAAATATTTCAGCTTCAATTTTAAAATGCAAAAAATTTTAAAAACTTCCA
TAATCAAGGTACCACAGGACTTTTCGTGACGGGACCCAAAAATTTCAAAAAATAATTTTT
TTCAAAAATTTTCAAATCTCCAAAAAAATGACTTACCAGTTCCATTCGCATAAATCATCA
GAAAAATATTGGGAAACGGAGATTTGTGAATATCGGCGGTTTTCGAGTTGATGAAGCACG
AATTCGGCGTCCAGAGCTTCTCCAGGAGTACCGAGTTCAGGGATAAATTGTACTTACAGG
GGTTCATAAACGCGTAGTTTAGTGCTGGATCATACCAGGTTTCGTATATGTAGATGTCAA
GCTGGAAATTTGAATTTTTCGAGAAAAATTTTTTTTTGAAAAAAAAATTTTTTTTCAAAA
TTTTCAAAAATATTAAAATTTTTCAATTACCTGAAAATCCGATGTGATATCCGAAATTGT
CGTAATTTCTTGCACCCATACTTCTACCTCAACGTCTACCTGGAACATTATCGATTTTTT
AAAAATAAAAAAAAATTGAAATTTTTTTTTCCGAAATCTTCCAATTTTCTGGATTTTCAG
TGAGTTGTGTGATTGGAGACTAGAAAATATGAATTTAACGCAAAATTTTTAAAATTTTGG
CACCCATATTGACTATGTTCCGACAATTTTCAAATTTTGGGCCGAAATAGGCCGAATTGG
GCTTAATTTAGGCCATATATGAGTTGGAACTGATAATTCCTAATTTTCAAAATTTATTCA
AAGGTTTCTTTGGCTTGATACCGATATTAGCTATTTTTCGAAAATTTTTTGAGTTTCGGG
CCAAATCGGGCCGAAATAGCCTGAACAACGGCCTTTTCCAAGTTGAATTCCAACAACCCT
TTAATTCTCAAGTTCTGCACATGATTTCTAAAAAATTGAAGCTTATACTGATTGTTTCCC
GAAAAATAGGGATTTTGGGCCGAAATAGGCCGAACTGGGCCGATTTGAGTTTAAATTCAG
CTCTTATGGGCCTTAACCATTTTTCAAGCTATTTTTTTTTAGTTTTTCAAATTTTTTTCC
AAACATTTGACGCCCATATTGGTTAAACTTTAAAAATTTCTAGTTTCGGCCGAATTCGGG
CCATTTCAAGCCTAAAATTCAATTTTCTGCAAATATAGTCAATATGGGGCTCAAATCAAC
GGGAATTTCACGAAAAATTCAAATTTTTAACTCCCAAAGCCGAAAAATTGTTAGTTTTCT
GCCTACCTGGCCTCCTGGAATTTTGTGCCTATTGTAGTTGCTCATAATTGTCCCCAGTAT
GAACGAGTCGTTGGCGCAATTTTTTGTGGCTCTTTCCACCTAAAATTTGAATTTCATTAA
ATTGGAAAAAATTAGAAAAATATTTCAAAATTTTTTTTTTCGAAATTTCAAAAATTATCC
AAAATCTTACCTTTGCCGGATTAATAATCGGCTTGAGCCCACCGTGCTCATCAACTTCCC
AGTCATAATTTCTTGTGAGCCTCCGGAGACTTGGAGAGTTTCTTCGATATACTGATTTTC
TGAAAAATAATTTTTTTTTTGTAATTTTTTTTTCGAAAAACCGGAATTTTTCCCTCAAAA
CTTGAACTAAAACGACTGTTCTTATTTTATCCATATTCAGCGTGTTGAGAGCTTTCGAAT
GACCTCCAACATGCCTATATTCCGTCCAATTTGAAATTTTGAATAGCCCGACACAGCTGA
AACTGGTGCTACAGTACCCCGCGTGGTGAGACCCAAAATTTTAAAATTGGCCGAACATAG
GCATGATGGAGGTCATTTCGAAGCAGAATTTTACGGAGAATCTGAATTTTTAGGTTTGAA
AATCTAAAATTTCGATATTAAGTCTGAAATTGCAAAATTTCAGTCAAAAATTAAAAAAAA
TTGTTTTTTATTAAATTTTTTTCAAATTTGATTTAAATTTCTCTACAAACCTGGCGTGAC
ACATAAGTAACAGAACGACAAGCGATAGGAATTGCAGATATTGCATTGATGCATCCGTGT
CGCCCCGCCCCTTTCTTGCCACGTGGATTTTGTGGAGGGAAAAGCTGAAAAAGCTGAAAG
TTTGGCCGCTCAACAGGGGGTTTTTGTAGGGAAAAATGCGAAAATTCAAGGAAAATTGAA
AAATGGAGCTAAATTGGGATAAAAATTGGATTTTTGAAATTTTGAAGAAAAAACAACTTT
TTTAGGAAAATTTCAAAGAAAATTTTTTTGAAAATTAAAAAAAAAAAAGTTTTTTAAAAA
TTTTTTTCCCTCTGGATTTTCAGTATTAAATGCTGATACTGTTAAAATTTATAAAAACCA
TGTTAGACACCCTAAAAATCCAAAAAAAAGTTTTTTGGAATTTTTGGAAATTTTCAAAAA
ATTTTTTTTTTTTTGTGGATTTTTAGTGTTAAATAAAAATATTGATCAAATTTAAAAAAA
AACCATAATAAACCCTAAAACCCTAAAACCCGACAAAAAATACAAAAAAAACCAAGAAAA
AAATTTTTGGGCTCAAAAGTTTTAGTTCAAAAAAAAATCGGAAAAAACAATATTTTTTGG
CCAAAATCCTAAATTCAAGCGCTAATTATCCAACAAATTTTTTTTTCCAAAAAACACAGT
AAAAAATTATTTTTCAACCAAAATTTCCAATTTAAGCCCTAAAAAGTTTTTTTGGGCTCA
AAAATTTTAGTCCAAAAAAAATCGGAATTTTTTTTTGAACCAAAATCCTAAATTTAAGCC
CTAAAATATGTAGCAAAAAATATTTAGGCAACGAAAAAAAAATTCTGAAAAAAAAATCCG
AAATTTTTAATTATTTTTTAGGGCCAAACTTTTGTAATATAGTAACGGGAAGCGATAGAT
AGATGGGTGAAAAAATGGTGGTGGAGGGGGAGAATAAGGAAAAAGCAAAAGGAAAAGCAA
AAAATTTCGGGCTCCTCCTCCCCCTCCCCCCCCCTAACATAGGGCTCCGCGTCCGTTTGA
CTCCGGCCAAGGGGAGGGGGGGAGACGTCTTCGTACGTCTCCTCCTCTCAATTTAACATC
TTCTTCGTCTAACTATTTCGAAAAAGAAAACGAAGAAGAAGAAGTCTTCTTCTTCTTTTT
CTTCGTATTTTTCTTAGTAGTCGTCGTAGTGTGTCCTCCTCCCCCCCTCCCGCTCGCCTT
GCCTCGGCTTCTTCCTTTTCCACCAATACTTTTTTCGTTAAAACGAAGAAAAACGACGCG
GCGGGGCGGATGAGCAGCTGCTCTGGCAGATGAGATGGGAGGGATGGCCTAGAAATTCTG
GGTTTTCCTCGGCCACGGTGATTTTCAAGGGAAGATGTCGTCGATGCACCATGAACTACT
ATTCAAACTGGTGGCCTAGAAACCCGGGTTTCCTCGGCCACGGGTTTTTTGTTTTTTTAC
CGGATAATGGGAGTCGATGCACTATAACATACTATTCAGGCTGGTGGCCTTTGGAATTGG
TGGCCTAGAATACTGGTTACCTCGGCCATGGCAATCACCAAGAGATAGGGTCGATGCACC
ATAGCCAACTATTTTTCAAATTGGTGGCCTAGAAACCCTGGGTTTTCCTCGGCCACGGTG
CTTATCAGAATTGAGATTGGGTGAGGGTGTCGATGCACCATGCCCTAAAATTGAAATTGG
TGACCTAGAAACCCGGTGTTTTCTCGGCCACGACGTTTTTTTTTATTTAGGGGATCCAAT
GCACCATGACTTACAATTCAGGTTGGTGGCCTAGAAGCTCGGTTTCCTCGGCCACGGCAC
TTTTCAAAAAAGGTTTACACTGTGCTACTGGGTCCCACCACGAAAAAGCTTGGCGTACTG
TAGTACAATTTTTTTTTTTCAATTTTTCAACTCATTCTCAAAAAACCGGATACTTAACCA
ACATTTCAAGCTAAAAATTTTAACAAAAACTCAATTTCTGAAAAAAAATTGATTTCTTGA
AAAAAAAAATCTGAAAATTGGAATTTTCAGCTGGTAAAGTCTTGGTCTTGGGGTAGCTTT
TATGTCGCCATGTTTTATAATAGTTTTTTTTCTGGAAAACCGAAATTTTCACCTATATTT
TAAGCTAAAATTCACCGAAAAAACTTGGTTTTGAAAGAAATTATGAAATTTTCAAATTTT
CAAAAAAAAAAATTTTTCGAAAAAATTTTTTTTGCCAAAATTTTCAAATTTTGGTAATTT
CTTGGGAAAAAGTGTTCCAAAATAAAATTTTAGGCAAAATTCATTTTTTTTTAAACATAT
TTTTACATTCATTTTCATATTGAACCAGTAATAAATCCAGAACTTTTCAACAAATAAAAG
TTCCAAAATTTTTATTTAAATTTTTTTGAATTTTTCTACAAAAAAACGTCACTTTCAATT
AGCAATGCAAACGTGCTCTATTAAACTTTTCACCAAAAAATTCAAAAATTCAGGGGGAAA
ATCCTGGTGTGAATAATTTCACAGAAAGTGGAAAAAAAAATTCCAAAAAAATTTTCGAAA
TTTTTTTTCCCTTTTTCCCACGGTTTCTATGGCAACTTTGGGAATTTTATGATGAAAAAT
AAAAAAAGAAAATAAAAAAATGAAAAGATTAAGAAAAAGAGCACATGAATCTTATAATGA
TTGGTTGTGCTCCCGGCTCCCCGGCCAAAAGGGGGAGGGGCGTGAGCAGGAAGTTTTCTA
GGCGGAGAGCACAAAAAAGAGCACATTTTATTTGTTTGAAGTGTAGGCCAAGAGCCAGGA
GCACCTAAACTTCAATTGAATTTGAACGGCCTTTAGATTGAACTTGGAAGAAATTGCGGG
AAAATTGTAAAAAAATGTTGTTCGGGAAAATTGGGGTCCCGCCACGAAAAGTCAAAATGA
CAAGATATTTTTGCGTATTACAAAAAAAGAATCACCAAAAAATCTTCAAAACAAACAAAG
TTACACAATTTTGAAGTTTTTGGAAAGAACTTTTTTTTTTTGGAAATTTGGAGTCCCGCT
ACGAAAAGTCCTGGGGTACTGTAGTTTTTGAATTTTCAGTTTTTATGTTTTTTAAATCAA
GTTAACAGGATATTTTTGCATATTTCAAAAAAAAAATCACCAAAAAATCTTAAAAACCAA
CAAAGTTACAAAATTTTAAAGTTTTCAGATTTTTGGAAAAAGAATTTTTTTTTTTGAAAT
TTGGAGTCCCGCCAAGAAAAGTCCTGAGGTACTGTAATTGCAGGTTTTTTAGTTTTACTT
ACATTTTATCAAATTAACACGGTGTTTTTGCATATGTGAAGCAAAAAATCATCTGAAAAT
CTTAAAAACTAACAAAGTTACAAAATTTTGAAATTTTTAGGTTTTCGGAAAAAAATTATG
AAAAAAAAATATTTTCAGAATTTTGATAGTTCAATTACTGAAAACTGATACTTTGTAAAT
TTTCAATTTATAAGTTTTTCAAAAAAAAATTATTTTATAGAAAAGTTCTGAATTAACTTT
GTAATACGATACTAAACCAACAATAAAAAATTTTTTTGTTAAATGTTTTTTTCAAATTTT
TTTAAATTTTAAAACTCTCAATAAGGCTTAAATTTTGAGCTTATGCTTGGCCTAAAATAA
TTTTTAAAAAACACAAAAATTGAAAACTACAGTACCCCAGGTTTTCGTGGCGGGACTCCA
AACTTCAAAAAAAATTTTTTTTTCCAAATTTCAAAAAAAAAATTCAAATCTTTGTAACTT
TCTTAGTTTTCAAGATTTTTAGGTGATTTTTTGCTTGAAATATGGAAAAATATTTTGTCA
ATTTATTGAAAAATTAAATACAAACTGAAAAAATCGGAACTGTAGTTCCCCAGGACTTTT
CGTGGCGGGACTAAAATATCGCAAAAAATTTTTTTTTTCAAATGTTCAAAACCTCATAAC
TTGGCAAATTTTAAAGATTTTTAGCTAAATTTTAGCTTAAAATAAGCCTAAAATAATGAG
CTAAAAATTAAAATTATCAAAAAGTTTTATTCGTTGAAAATCTACCAAAAAGTATAATTC
TTCGTGGCAAGACCTAAAAAAAATTTTTTTTTCAAAAAATTCCAATTTTTCAGGAAGTCA
AAAGATGCGTCTCAATGGGTATAAAAGGATTTGAAGTTGGTTCCCACGTGGCAGAAAAAT
CGTTGGATCATCGTGATTTTTGGCCGCTTTATAAGGTTAGTCGACAGCAAAAAAAAAGTA
CGAAAATCAAAAATTCTGCGTCGCCGCCTCCGGGAAAAATGCGCGGTTTGTAGGGCAAGA
AGGGGCGGAGCCTATCATTTATTCATCGTTTGACGCACATTTTATATACCCGCCGCTGAG
CTTTTTTACCCGGGGATATAGTTTGGAAAATTAGAAATTTAGAGGGGGAAAAATGGGAAA
TTGTGGAAATTGTTTTTCTCAATTTTGAGATTTTTGAATTTTAAATAAAAAAATTGAATT
CAGCTCACCGAGAGCTTCAAATTAAGTACCATCATGCCTGGGTTCTGTGAATTTTTCGAA
AATTGGGGTCTCACAACGAAAACTCCAGGGGTACTGTACCTACAATATAAAATTAAGTTT
TCACATTTTTTATGATTTTTTATGATGCACTGAAATTTTTCTAAATTTTATGACTAAATT
GAGATCCAAGCCGCTAAAACTGACAGAGTTATTGAATTTCGAAAAATTGCGAATAATTTT
TTTTTCAAAACTACAGTATTTTTCTTTCTTTCTGTGCATATCGTGGCGAGACCCACAAAT
CTATCTTGTTTGAATTCAGCTCACCGAGAGCTTCAATTTGAGTACCATCATGCCTAGGTT
CTATAGATTTTTGAAATTTTTGGGTCTCGCCACGAAATCAATCCGGTTACTGTACCTGCA
GAAGCTGACCTAGATTTGACATTTTTACAGTGTTAAAACACAGATTCTGTATGACTTCCT
ACAAAATTTGTTTGGAAATCTCTAAAACTCACAAAGTTATCGATTTTCGAAAATTTTCGA
ATTATTTTTATCTCAAAAAATTTCAAAGCTACAGTAATTCTGTGAATTTTGTGGCGAAAC
CCACAAAACTATGTTTTCTGAATTCAGCTCGCCGAGTCAGCTCGCTAAGTACCATCATGC
CTGGGTTCCGTGAATTTTTCGAAAATCGGGGTCTCACCACGAAAAACCCCGGGGTACTGT
ACCTACAGTAGCCAACTGGAGTATAACATTTTTAAGATACAGAAATATAATTTTCCTACA
TTGTAAAACAAAATTTGTTTGGAAATCTCTAAAATTGGCAAAGTTATCGATTTTCGAAAA
TTTTCGAATTAATTTTTTTTAAATTGAAACTACAGTGGCATAGCGAATTCCGTTGCGAGA
CCCACAAAAATATGTTGTATGAAATCAGCTCACTGAGAGCTTCAATTTAAGTACCATCAT
GCCTGGGTTCCGTGAATTTTTCGAAAATCGGGGTCTCGCCACGAAAAACCCCAGGAGTAC
TGTACCTACAGTAGCCAGCTGGAGCATAACATTTTTAAGATACAGAAATATAATTTTCCT
ACATTGTAAAACAAAATTCATTCAAAAATCTTAAAAACTGACGGAGTTATAGATTTTCGA
AAATTTTCGAATTTCTCAAAAATTCAAAGCTACAGTAATTTTGTGAATTTCGTGGCGAGA
CCCTCAAAACTTAGATAAATGAATTCAGCTCATCGAGAGCTTTAATTTAAGTACCACCAT
GCCTAGGTTACGTCGAATTTTAATTTTCTGGGTCTCGCCACGCGGGGTACTGTAGCTCTA
GTTTCAGCTGTGTCGAAGCTAGAAAATTCAAAATCGCCTGATTATAGTCATGATGGGTGT
CATTTGAAAGCTCTCGGCGAGACGAATCCAGCTAAAATATTTTCAAATCAAAAAAAATCA
AAAATCTAGTTTTCAGATTTGCGAGGAGCTCTCGGTGGTGCTCTTTGTGCATCCTTGGGA
TATGCACATGTGGGACGGGCGGCTGGACAAATACTGGATGCCATGGCTCGTCGGAATGCC
ATCTGAAACTGCTCAAGCCATTTGCTCAGTGCTCATGGGCAACATTTTGGTGCTCTTCCC
CAAGTTGAAGCTCTGCTTTGCACATGGGGGCGGCGCCTACCCACAGATTCGTGGCCGAGT
TTCTCACGGATGGAATGTTAGGCCAGACTTGTGTGCTGGAAAGTGTAAAGTTGCTCCGAA
TAAGCTCGATGGGCTACTGTGGACGGATAGCTTGGTTCATGACCCAAAAGCTCTCGAACT
GCTGATAAATACCGTTGGAAAGGTGTGCAATTTTGATTTTAGAGAGTTCTAGATAGAAAA
TTCGAATTCCCCGCGTCGTCAGCTTTCAAATGACGCCCATCATGACTATGCTACGTTCAT
TTTGAATTTTCCTGTTTCGACACAGCTGAAACTGGTGCTACAGTACCCCGCGTGGCGACA
CCCAAAATTCACAAAATTTCGAAAACCTAGGCAAGATGGGTGTCAAATGAAAGGTGTTAA
TGTGCTGAATTCAAAAATTCAAATTTTTTGGGTCCTGCCACGAATTTGCAGAAGCTGAGG
CAAGTTTTCGTGGCGAGACCCAAGAAATATTGCGAAATCTGTCAAACTTGACGAAAACTA
GTTGATATGGGGCTTATTTTGAAGCTCTTGACTTGCTCAATTCAAATTTTAACTTGAAAT
CAAGAAATTTGTGGTCTCGAAGCGACAATTTTCGAAAAAAACTTGACATTCGCGAGAAAT
CCGTCAATTTTCATCATTTTTTCTCAATTTTTCAGGAGCATATAGTGCTTGGCACCGACT
ACCCATTTCCGCTTGGCGAGCTTGAAGTTGGAAGAGTTGTGGAAGAGTATAAGCCATTTT
CTGCCAAGGACAGGGAGGATTTGCTGTGGAAAAACGCTGTAAAAATGCTGGATATCGATG
AAAACTTGCTTTTTAATAAGGATTTTTGATCATTTTTTGGTTTTTATTGATTTTTATTGG
GACATGTTGGGTTTTTATTGGTTTTTAATAAAGAATTTAGACTTTTTGTTCGAAAAACGA
TGTTTTCACATTCAAATACCCGCCGAAAACGAGAAATGCGCAAGAGTGGGGTTGCTGGCG
CAATACTCGATTTTGCTGACGCGTTTCTCGTCTTTTTGAAAATACATTTTATTTCATCGA
TTTTCGCCGGATTTTCGCCGGTTTTTCTTGATTTTTCTTGATTTTTTGCCATTTTTCAGT
CAAATTTCATCGTTTTTCTCGATTTTCTTGCCAATTTCCAGCATTTTCAGTGAAAAAATA
GCGGAAAAATGGAGGAAGAGCTCGCCTCTTACAAACTTCAGCTCCAGCAGGTCGAGGCGG
CTTTGCTCGGCGATCCGACGAATGTGGAGCTTCTCAAGTTGAAGGAAGACCTCGGGGAGA
TTATTTCGCTGCAGGTAGTGTGAAAAAAAGCGGAGAAAATGCAAAATTTTCGAAAAAAAA
TCAATAAAAACTGATTTTTTTCCAATTTTCAGGAAGATTTGGCGGAAACCGACAAGGCAG
AATCATCAGAGAGGGCTGTGGTGGCTCCGCAAGTGATTCACAAGTGGACGGTACGGATTT
TCAGCGAAAAAACCCCGATTTTCGCCAATTTTTCAGCTAAAAATCGATTTTTCAGGTCGG
CGAACGAGTTATCGCCCCACATCCCGACGGAAAAAAGGTTTTCGCCAGAATCGACTCACT
TACGCCCGCCGGAGTGGCTATTACCTTCACATGTAGGGGGATTTTATCGATTTTTAGCCC
AAAAATCGTGAATTTTCACCAAAAATTCGTATTTTTTCAGCTACCGGCACGAAAACCATC
GTAGATCCCGCTGATCTCCAACTCCCGCCCGAAAATCAGCGAAAAAATTATGCATTTGAT
AACACAAAGTCGGCGGCCGGACCATCGACTCAACACGGCAAAAAGGTTGGAAAAAATGGA
AAAAATTCCTTGTTCTTCTGTAAAAAACCAGAAAAACCCCGTTTTTGCAATATTTTTGAG
CTAAAAATCGCAAAAATCACCAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1087, 1530..1597, 1693..1775, 1825..1933, 7185..7316, 24533..24634, 26356..26721, 27215..27464
1063..1087, 1530..1597, 1693..1775, 1825..1933, 7185..7316, 24533..24634, 26356..26721, 27215..27385
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved