Caenorhabditis_elegans Locus rps-29
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rps-29
Caenorhabditis_elegans
rps-29
III
B0412.6, B0412.7
1105..1232, 1448..1573
2788
ctccgggtagtgttttttaattttttttcgttaaatttttattaggaatttttcgaact
aaaaacgaagttttgtcagcttttagctctttaagaaaatcagaatagccactcacccca
ttcgacgttggcacgccacgacgaatcggacaacacgtcgacaaaatccggaatactggc
gagcagacgattgctccggtcgcccacatggttgaataattgattgtggcggtatcagtg
agaaaatgttatcagtgaaataaaaaaacggggaaaaatagttaaaatagtgagtttcta
gggtgttttctcgctacatagtacgaaaatcgtgaataatataattaaatttcagatttt
tcgaatttttttgtctgaaaaaattttggagcacaaaaatgttctttcctgtcgtttttc
cattcaaaagcgcggctcctccctcctaaacgacccgaaggaggcggagcagtcttggtg
tgggtctcgccgcgactttgacacacgtgaaacgagtgtgaccgtacccgagtggcggag
tgttctgcaaaaattgcgtttttcttccttttggcctatttttcgatggatttttgtgtt
ttttgttgttaaaaattcgaaaataaatgaattttttgttggaaatcaaaatttcgtgca
ttttctcaccaaaaacgtcaacattttgctaaaatcgcccgtattttctgcctcttggcc
gaaaatcaagtttttcgatctattttccatatttttgcaaggaaaacgattgtttccgta
attataagtagcagaattaaattagaagttttgtaactagttcttctggaaagatttcga
aaaataacgaaattttacggaaaatgctgttgttgctttaattatcgattttttgacgca
tttcgctttttttctcaccgtcttcttgttttccgcttttttcctccgtttacagctttt
tcgaaacattttgcattctgagatgttaattttgtttccatttcagctctcgacaatggg
tttccaaaatttgtggttctctcacccacgcaagttcggaccaggatcccgctcctggta
agtattattttcatcaaaaatttcgaatgcagatgtccattacgaaaaggctctttacct
tttgacgtttagttaaatttgcgaaataaaattgatgtctcgaagacatgtgcttcatat
tttgatgctcatgttcaagatcagcaaacaaacctgaacttggtgtatttcaaatacatt
tatctgaatttttcagccgcgtctgcgctggacaccacggacttatccgcaagtacggcc
tcgatctctgccgtagatgcttccgcgagcaagccagagacatcggattcaagaaggtaa
atttaactagattatgcaaaaaaggaaccttatccaactaaaataatatttaaaagttca
agtaggatgagcagatgtccattacgcgaatgcctgtgcttttcgacgtttagtttagtc
tgcaagatagaattgatgtctcgaagacaggtacatcagcttttagagttcctgttcaag
atcagcaaacaaacctgaacttactgcaaatatactttaaaataaataagtattttatta
tctgtcaacttatttttttttcagcttgattgagcaaccagcgtccacgtctgcaaccgc
ctcgtcaaatcttgttattgttaacttcatgtcttcaatcaataaattgttggcataatg
tctatgttataattttatgtgaataataaaacaaacggttcaaatctggaggaggactac
ttttttattggggaagggatagtagaaaccgttcaattgtagcagatggatccagtagaa
gcaggtgattggatagccggtcggccacttcaacttgtcttcctgtcgggattaaatcca
gtgaataagccagctcacaacagtatcgtcaatgtcttccggtacattgaaacatgaaga
acttcctcaaacgccaaaaataatttagaaaccgcacagccgacaaaccaccacttcata
ttcgcgtagtttccggagaattggatattccaccgaaacgggagactgggtcaggaaaag
gtgccagaaactgacaaaatatcgattaaaaacgtcgattttccaggaattctccgccgt
gagtggcctcaaaagtatctggataaggtaccggcactgattgtcgtgttcattgattta
gaatgggatcatccatcttgggaagagaagaagactgaagcagagagcaaagttgcaagt
ataagaggatcgctgcgtcatgggacgaaaattgcgctcgttttgattcagcaaaagtga
ggaaatgctgaaaaaaaacggtcatttccatgaaatttccgtaaaaagtgactaaatatg
ccgatttccgtgttattttttcatgaaaaatggtgatttgattgtaattttccattaaaa
actacagaaactggcaattttcgtagaattttgtggaaaaatgaccgaaaagggtgattt
tcgtgtaattttcctgtaaatacgcccgaaaaagctgagcatgactatttccatgcgatt
tttcataaaaatgactaaaagttttgattttattgtagttttcaattaaaatgacaggaa
attgcaattttcatagaatttcgttgaaaaatgacaaaaatttccatttttcatgcgaat
ttttcatgaaaactgactaaagttgcttttttctgtgaatttttctgtaaaaacgcccga
aaaagcttttttaatgaaaaatttctaaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1276..1375, 1644..1788
1015..1076, 1276..1375, 1644..1652
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved