Caenorhabditis_elegans Locus F19H8.4
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F19H8.4
Caenorhabditis_elegans
F19H8.4
II
F19H8.6
2015..2082
8487
GAGAAAAGCTTGATAGTTTGATCTTGAGAAACGAGAATTAGAATACAGTCTTGTTGAGA
AGAGTTCATTTTGATAGGGTTTTCTATTATCATTTTCGAAGTATTAATTTCTGTGTACGC
TGAAAGTGCTATCGAAACTCTAAACAAGAATACCCGTGTTCAGAAAATTTGAAGTTTTAG
ATGGCAGATGTATAAAACAAGCTCCATTTAGTTGCAAATTGCTCCTAGCATCTCGCAATA
TCCACGTGTCGGTCTGGAAATAATTACTGTAATTTTTCTATCAGTCTTGCACTTTAGCTG
AATAATTGCAAAATAGTATAATACAAATAGAAAATATTAATGTATGTCATTTCGTCTTCT
TTATATCTACTTTTTGAACTTCTTCGATGTGTTTGTAAATATAATTTCCGCTGAAATTTT
TTTTAGCAAAAAATTTTCATACTTTTTTCAAACGATTTTTTTTTACAATTTGGAAAGGCT
TCCAAATTGTTCACAATTCATGGAAATGGCCTAGTTCCTGACAAACTGAAAAAACAGTGC
CTCGAGCCAAAAAAATTCTCAGCAGGGGCTTCAAATTGAAACACACCTGCCAAAGTCTGT
CAAATTTGAGTGTACATTTTTATGTCTAATTGCGAACGACGTGCCGTTGACAACGACAAC
AACTAGATTCAAGACTGGCGTTCAATTACAGTAACCCTGAAAAATCATCAAAAAATAATT
GTCCCATTTTTGATGTTCATCAGAACACAAAAGACATGGTATCTCTCAAATATCAATTTT
GCTGTTAGAAAAAGTCCTGAAATCTATCCTAACGTCTTGAACATCATTTTGAACCTATCC
ACGTCTCCTCTTCATCCTCCTCACCTCCTTCTCATCTATTTCGGTTTCCCATCAACCCTC
CGCTTACAGGACTACGCCCCGAGAACGCGCCGCCCATTTTGTCTCCGGAGAAGCCAGGAT
AAGAACTTGGATTTCTGGATTCATTTTATCTCCTTTGCAATAATAAAAATGCAACTTTCT
GTCAAAATGCTTCTCCTACTATACTGTATCTTGTTGACCTACAGTGCAGAAGGTAGCCTT
TTTTTTAATTTGCTGCACATAGTTTGATGTAGCTTAGTTTTTAATAACTAATTCAAATCG
CTTTACTTTATTTCGGAAAAAATACATTGATATCCCTGGCTCATGCCTACCGATCGTGTT
TTTCTGCAATTTGACGTTTTCAAAAGAAAAAAGATTTTTAGCTTGATTAAGCCTGGTTGA
ATTTTCATTTTTTCGAATTTTTTTTCTGAAACTTTGGCAAGTAATTAAAATTGTTGTAAT
TGACCATCAAAATAATCTAAAATTTTATAGCCTTTTCATTATGTACAAGGAAAGTGTTTT
GTTTTTTAAAAACTTTATTGGTAAAAATAGGGCGAAAGCCCGCACTTCTCTTCGAGTGTC
ACGGACTCGTGATAAGTTCATACTGTAGTTGTGATAAGAAAGTGATAGATGACCCGTAGA
TAAGCTTGGTTAGATCAAACATTTAACGACCTCCCAACCTTTTGATAGGGTTACCGTACA
TTTTTGAAGGGAAACACGATGGGAAACCATTCGATGAGAAGGATCTGGATAAAATACGTC
TCGGCACGAAAGGTTTTGATAAGGTGCAAAGAGAATTTAAATTTAGTTTTTTTAACATTT
AATATTTTCTTCCAGGTAAAAACGATCCACACAAACTGGTACGTGCATTCTATGAAAGCG
CTGATTGCTCAACTTTCGAGAAACTTGCTCCCGAAACTTAATGATGATCTCAAAACGGAA
TTTGTGGAATGTCTAGCTAAAATTCATGATAAAAAAGATCTCGTGGAATCTTCAAAGTGT
GTGATGCGAGCTAGAGAGCAGTACAAAGTACAAAGGAAGTGGCAACCAAGAAGGTAAGTT
ATATAGGCACGTGAGACAGTTTTCGGTGATGGACTCGCGTGGCGCAGGCGGTAGCGCATT
TCGCTGTTGATCAAGAGGCCACAGGTTCGCCTCCCGTGCGATGAAGGTTAATGATAAGTT
TCGGCTGACTCAAATTGATGACACCTTTAATATGCTGAGCACTTTTACTTTTTTTAAAAT
TTATTTTCTTTTTTCAAGCCCAGTAAATTTCAGACCAGCTGCCATCCCAACGACTACTGT
AAAAACTCCAAAGCTGAAAAAATTGAGCATAAAAAAGGTAGAAGCAATGAGAAAAGCTCT
CCCGAAAGAGCTTCAATTCCCGACCGCAACTGAAGTTCCAAAAATACGGAATGAAGTGAA
GATTCAAGCGAGAAAAGTTGACTCGCATAACTCTGAAAAGAAAAATCTTCTGGAAAAGAA
GAGAAAAGACTTGGCAATCGCAAGAAAAATGCACAAACTGAAAATTTCAAAAATATTGAG
TGAGGATCACAGTGAAAAAATGAAGAAGAATGAGAGAAGGGTTGAACTTTGTGGAAGCCG
AAGCTATTGCAGTGGAAACAATTTGAGATCATCTTCCAATAAAGAAAATCTTATTCTGGA
ATTCAAGAGGAAATGGAGGAATCAGAGAAATTTGAGAAACAGGAAAGTTTTGAGGAGAAG
CAAGAGAAGTTTAACACGTCTTGTTGTCGATTCGGTATCCAAATCTGATTCACACGGATT
TTTTGTGAAAAATATGGATCGAATGCCAAGTTTGAAGACAAAGGAAAACAAGACGCCCGT
TGAGAGAATTACCAAGCTTCTCCGGACTTTTTTCAGCAACCAAACAGAAGCGTAAGTTTT
TGATATATCCCGAAAACGGACTACTCGGACTGTGGAACAAGATCTATGGATTTTGAAGGC
TAATCTTCAGACTAATTTTCACGACAGAACTCATTTGCTTTTAGCAATTTAGAAAGAGTT
CTTATTATCCCAAGTACATCTTAGGGAACTTTTTATACATTTTTAATTTTTCGACCAAGT
CCATTTGAAATGTTTATGCAAAAGGCGAGGAAAAAGAACCCGTCAAAAAGTTTTGGGAAA
AGTATTCGATATTTGAAATGCACAATTTTCATTGTTTTCATCAATCTGGTTATTTTCTAG
TAGTTTTCAAGTGTTTAGCTTTGCGCATAAAAGAAAGCAGCACATGTATCTTTGGTACTC
TTCTTTCACAATTCTTTCACAAATCACTCGAACAGTTGCATGTATAGGTGATCTCAGCTC
TCTGAAAAGTTAATTTTTTCAGAGATTCAACATGGGCAGACACTTACAAGGCACTGGTAA
ATTTGAAGAAAAAGATGGATAAAAAAGAAAAAGAGTCCGGCGCAAGAGTGTACAATGAGC
GAATGTATGATTTGGTGCTTGATATACCACAGAAAAATCATGATCTGGCGTTTTTCGACA
AGGTAGGTAGATAAGGTAGTACATGTAGAATATTAAATTAAAATAGAATTTCAGCAAAAA
ATGCCAGGAATCGTGCGTCACGCATTTGATTTGATGTCAACAATTGAGGGATCAAGTAAG
AAGAAGGGAGATTCTAATATCAAGTTTTTGAGGTGAGATTTAAAATATTGAAATTGGAAA
CTCTAAATATTTCACTTGTGATCGTGCAACTTCTATGGAGCCCTCAAAAAAAATTGGGGT
TTTTACAGGAGCCACATGCTGGTCAGTTGCTATGTGCACTATTGAATTTTACTCTCACTT
ATATCAAAAACTACTTTTTTCGTTACCGTATAACAAACCACTAGAGCTTTAGGCATTCTC
GTTACTGGCAAAAATGCAAAACTGATAAGTTAACTTGTTTCTTCTATGTAGGTAAGAACC
CTTCTCGACTCCTCCCCTCACTCAATTCGATAAACTTCCCATGTCATTTTCCACTCTCCA
CGCAGAAAACTGTCAATGTCTCCCCTCTCTGCAAAATCTGACTGAACACAATAGGCGATC
AATCATCTAGGGGGTCAATAAGGTGTAATGTTATGATAAGAACAGTGTTGAGACAATTTT
GAAGAATGACACAAATATCGAAGTTTGACACCTTTTCTTGCTATTAGATAAAGCTGGGCT
GGGAAGTGGGAAGTTTAGTAATATGGAAACAAAGGGTGAACGGCAATTTCCGATTTGCCA
GAAATTTTCAAATCCGGCAATGTGGCGATTTGCCGGAAATTTTCCTTTTATGCAAATTGC
TGATTCTTCGTTTGACGAATATCAATTTGCCGGATGTTTTAAAGAAATTTTTTATAAGAC
GGAAACACTAAAAACTATGCCTTTTTGAAATTTTTTCCCCGTTTTCTTTAGATATAACGA
ATAAAAATTGAAGTTCTGAAGGTTCAAAAAAATGTGCAAAACCACAATTTTTCAAAAAAT
TTTGGCAGATTGACAATTATCCGGTTTGCCGAATTGCAGGAAATTTTTAATTCCGGTAAT
TTGCACATTTGCCAATTTGCTGGAAATTTCAAATCCGGCAATTTGCCGATTTGCCGGAAA
AAATTGCTTGCCACAGCATAAATCAGGCACGTCAATAGACAGCTGCGTGGGCATCTAGGC
ATAAGGCACAGAGGCATGCACAGACGAGAAGGCGCACATATCTACCTATTTGCCAATTTT
GCCTGTATGCCTACCTACCTACTAATCCGCTTCCTGCCTGCATTATGCCTGCCTCACGTT
CTCATGTCATATCATTGAAAAGCTCAAAAGTGAACTATAAAAAAGGCCAGATATGAAATT
TGAGTTGAAAAAGATCGAGTATCAAATTAAAATCATATAGATGGTAGACTGACAAGTGAT
AACCGGAGAATAACATTATCACCTTTTCCGTATCATTTCAAGGAACTTGACCTTGTTGTG
TTAGGTTATCATTGATATGAAAATTGAAAGAAAAATTAAATAGCGATAATATTGGAAATA
AATCACCCGAGCGTCTGTAGATCAAAACAGTGAGCACATAGTTAATCACAAGTCATCCAA
AACTACTAATCAAATTCTAAAAATCATTTCCATGATCTTTCAGTCCACGTTTCGCTGCAG
TGATGCCGGATAAGAACGAGAACCGTGGTCGGCTGTCGCCATCGATTCTGTCATTCTACA
ATGATGAGTCGGAAGATCAAATTCTGCCGCTTCCAAAGGTGAGAAGTTCAGAAGATTATC
ACAGAATAAGGTGATGGAGAGAGATTATTATCAACTTATCGGGATGTATCAAAATCTTAT
GATTAACATGATTCAGTTGAAACTTTGGTGGTGTGAGTGTTAGAAAACGTAAACTTTGAA
ACTAAATTCTAAAGTTTTTTTTCATAGGTCGGCCAAATGAATATTCCAAAAAAAGACTTC
AGCTTGAAATATCTTGTCCCTGAAATTGTATACAATTTTTTGTTAACAACGTTTCGTCAA
CTCGATACTGGAATGAGTTGAAGCGGCGGACATCTCGCAAGTTCATTTTGGACCACAAAA
ACAGTCTAAAATAGAGTTGCCAGATGTCGGACGTTTGATAACCTGGAGAAAGTACTTTTT
ACCAGGAAAAAAAAAACAAAATTCAGATGCTCGATGCTACGGGAATGCAAGGAAAAGACC
GTGACAGTATCATTGAGCTAGTGATGGAAATCTCTGGAGTCAAGGGAATTGTCCACGACG
CTATGAAAATGCTAAAATCCACCGAAATGCCAGAACTTGACCTAGCCATGGATGCGAATG
CAAAGAAATCTCTGCAAATGGTTCAGGACATTCAAAAGTCATACAACAGGAAGCAAAAGA
AGGAAATAAAAAGCAACGGGTTTACTTTGATGAAACCGAATCAGATGGAGAAGCTGATGA
CCGAGCAAGGAATTCTCGGGCGGGATGATATTTTCAATTTGAAAGAATATGCCATGATGA
CAATCGGGCAAAGAAAGGAAATGGTCTGGGATATGGTTAGAGGCATTGCTTTCGGACTTA
CTGGATTGGTTAGTTTAGGAATTTTTGAAAAAAGTAATTAATAGAATACAAAATTAAATT
ATAGATTTGAATTTTATGCAACACTGAAAAAATCAGAAAAAAATTAGAAAAACTTTGATA
ACATTTTTAACAATTAAATTTGGTCATTACGGTCCATTTTCTATTAAAAAAAGAAAATCA
CCGGAAAAAATCCACAATTACAGGGATCTCCACAACGTTCAAACTTCACTAGCAATAGTC
GTGTGAAGCGTCAGTCTTCAGTATGGGGACCGCATATTCTGACTCCTACCGTTTTGTCAC
CGATTCTTTTCACACCAATTTACGGGCTGAATGTGTTGGGTCCAACAGTGAGTTCAAGTT
TAAAAAAATACAATAAAATGTAGCGTTAAAATATTTTGCATTTTAGAAAACAGTTGCAGT
TTAGTCAAAGTTTGTCTAAATAATTTCAATAAGTAAAAGAGGATAAAAAACAAGAAAGAG
GCGGAGCCTGTTTTTTTCAATTTATTTGCATCGAACTACTTGCACTTTATGTCATTTTAA
TTTCCTCGATATTTTTGGTATTCTGTATATAATAGTAATCATCGTCACCAATTACATTTA
CACCGTTTCAAATGGCACAAATAAAATGGCCAGACACAAGAAAAATCGATAATGGTCCCC
GCCTCGGTTTTTGATTTTTCAAGCCAAATTTTTTCGATTTGCAAGTTGAACAAAATAAAA
TAGTAATACTTCCTTCAGCGATCCTATAAAAATAATGTCCTTCTACAAAGTTTTTTAATT
TCAGGTCCTCTCCCCCGGTCTCTTTACCCCACTGATCCTCAATCCCTCAGTACTCTCCCC
ATACGTCTTCTCACCAACAGTCGGAATCCCCTTCATTTTATCCCCGTATCTCCTGTCCCC
ATACGTGTTCTCCCCATTAGTCATGGCGCCGTTCATTCTTAATCCATATGTTCTCTCACC
CAACGTCTTCAATCCATACGTTCTGTCGCCATTGATCCTGTCACCATTGGTCATCTGCCC
CGATGTGGTGTCTCCGATGACGCTGGGTGGAGCGATCCTGTCACCTGCAGTACTGTCACC
TTCACTGTTGTCCAAGTCGTATGTGATGGCTAATGTGTTGTCACCGACTTTCTTGTCTTA
GAATGTTACTCATAGGTTTTATTTATACTGGTATTTTTAATTTTTAATTCACGCCTAATA
TTCATACATAGGCTTTTTTGATCTACGCGTTCTTTAAATCACCACTTTTGTGTTTTTTGG
CACACTAAACCCCCAAAGCCCTCAAAAACTTTTACCAACCTCTCTCAAAATTTCAACCTA
AACCCAGTCACCGTCCTGGTGACGCCCACAATTAAAAAATTAAATTTCCCATTTCACGGA
AAACAAAAAAAACATGCGTTGGAATTTTGTTGCCTTGGTTTGTTTTAACCTTTCAAAAAT
TGACGATAATCTGTTTACTGGTGATTTCTCAGTTTTTCTACACTTAATCATTTTTCATTT
TGTTCCTGCCCACATTTCCACAAATATTCTTGTCATAGCTAAGCTATTGTAATAATTATA
ATAATGATAATTTATCGAAAATTGAATGAAGATTTGAATTGAAAGTTTGGAAAATCTTGA
AATAGCATTGCAAGGGAATCCAAGAGTTGTCAAATTTCAGAATTAATGTGCACCGTATTT
AAGTCACAAAAATAAATCATATGTGCATTTAATAGAAAAAACTTTTATACATAACAAAGT
GATTGTCTAGGTGCCTATCTATTTCATTGCCTTTCAGTATATATACCGACATTTTTTGGG
ACAGTTTTTAAGTGGTCGATGTAGGTTTACGGCAGATTTAGAAATCCTTGAGTGCTTATA
GGCATAATGTACAACCTATGTATAGTCCCCAACTTGATAAATCCTTACAGCAATTAGTGG
TTAATACTCCTGAATAGGCAATTCCGACATAAGTTACTACTGTTATCGTTGTTAAAATGG
GTCAGACGGACAAGTAGGAAGCTTGCGGTGAAATGATATAGTTAGGTGATAACTTTCACA
CTTCGAACTGGTAAGATGGCTATCATCAAACAGTATTATCTTTTATTACTATTATTTGTC
AGCTTTTATTTTGTTTCGACGGCTTCCACAGAAAAGATCTCTGAAAATGAAATTCCTGGT
AGAAATTTTTTAAATTAAATTATAGTTCTGAAGCAAATTCTTAAAAAATTTAGAATCTCT
ACGATCTCAACTTTTAACAATTCCCGAAAAACAAAAACTAGCGAAAATTCATTATGACTG
GTATGGATACTCCTTAAAACGACTAATGGTACAATTGGGAAAGAGTGTTCTGAAAAATTT
GGATCTAGGTGAGCATTTTTCTTTGTATTTTCATTATTGATTTTTACTTTTTAATGGGTT
CAAACAAGTTTCTGAGTTGTCTGAAAAAAGTGAAAAAATCCGAAAAATCGGAAGAGCTGG
AAAACATTGCAAGATGTTTAACAAGGGCGAAGATGAAAGAGGCGAAGCTGAGAAAATTAG
GATGGAAAAGGAAAATGTAAGTTTTTTAAACTTTTTTTGCTATATAACTGTATTCAGGTT
TAAAATTGAAATTTCAGTGAAAAGCCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1071, 1569..1642, 1695..1912, 2133..2750, 3202..3361, 3414..3511, 4963..5077, 5486..5887, 6083..6226, 6664..7487
1008..1071, 1569..1642, 1695..1912, 2133..2750, 3202..3361, 3414..3511, 4963..5077, 5486..5887, 6083..6226, 6664..7017
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved