Caenorhabditis_elegans Locus F01D5.10
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F01D5.10
Caenorhabditis_elegans
F01D5.10
II
F01D5.12
3505..3592
4981
CCAATGATTAGCGATTTGATACGCCACTTGGCTTTTCCAAAAAATTTACAATTTTCTGT
TTAAATCCCCGGGTATCTGAAATTCCTGCCTTTTTCCAATATTTTTGTTTTCTCGATTTT
CAAAAATTTCCACATTTTCTCATCTCAGACATCTGCCTGTAAATTCCTGACTTTTAGCCA
GTCTTATCTATTTGAAAATCGTCACCTTTGTGATCTTCGTCATTCGTTTTTGCGCCCATG
CATTTTTTTTGGAAAGATGTAAATTTCGCTTCCACCTATCGCTTACTGTGTAACTTTGAA
AGCTCGCTAGTTTGAAACTATGTATTCTGCGTGCTGAGAATCCCTAACAGTACTCCTTCC
CTCAAAGTTCCATTGTACTTCAACAATACCCCTACAGTAATCTTCCAATTCTCTTACAGT
AATCATACAGTACCCCAACACTAACCATGCAGAACTGCTACAGTAACCCTACACTATTTC
CACAGTAACCATACAGTACTCCTACAGTATTACCGGTACAGAGAGTGTAGATAGTTAGAG
AGTGACAGACATCCGGGACCCAATGGGGCGGGGCGCGCGGAAGAGACGATTTGTGTCGAT
TTACGAACTTTTCCTCATTGTCATCATTTCGTAAATCGAGACAAATCGTCTCTTCCGCGC
GCCCCGCCCCATTGGGTCCCGGATGTCTGTCACTCTCTAACTATCTACACTCTCTGTACC
GGTAATAATCCTCCAGTTTTCTTACAGTAATCTTACAGTACCCTCACAGTAATCTTACAG
TATTCTCACAATAATCCTACAATACTCTTACAGTAGTTCTGAATTACTCCTACATTAGTT
CTACATGACTCCTACAGTAATCCTACATTACCCATACACTAACCATATACATTACTTCTA
CAGTAACCATACAATACTCTTACAGTAACCCTGCAGTACCCCTACGGGGCACCTACAGTA
ATCTTACAGTAATCCTATTTTCTTTAAGGATACCTATCAAAATGGTAAAAAAGCACAAAC
ACGAGTGCCAAAAACCTCCGCCGCTCCCAACAACACCTCCACCACCTCCAGTCGGGGAGC
TCCCAACACAGTACAAGAGGATGTCCTCAACCTTACAGCACGTGCAGCCACCTCGACGTT
CGAACCACGCATATTTATTGGTACCATTTGTCATCACAGTCGGGCTCATGTGGTTCGCAT
ATTCACAATGGAAGAATCCGCCGCAAGCTCAACTGCAACCATCTGTGGTTACTGATAGGT
GTGAGTTGTTTGGTTTAAATTAATAGTGTCAACTACAGTACTCCTATAGTAACCCTATGC
AGTAAACCTTAGTACAGTTGTCAACTATAGTACTTTTACAATACCCATACAGTAAACCTA
GTGTAGTAATCCCGAGTACATTAGTCAGCAACAGTACTCCTACGGTAACCCTATACAGTA
ATACTCAGTACTCCTACAGCAACCCCGTAAGGTAAACCCTAGTACAGTACGCCCACATTC
ATTGTACAGTAATTGTGCCTAGCAAACACTAGTAACTACAGTACTCCTACAGTAACCCTA
TATAGTAATCCCAAGTACAGTACCACTACAGTAACCCTGTCACAAGTACTATAATCAATT
TATGCTAACCTCCTCGAAACAAATTCCTGATGATTGATCAAGCCCGTATTAGGCGAAATC
GAAATTTTCTCAAATTAGCTGAAATTTCCTAATTTCCCTCTCCCTTTTACGGTTTAAAAT
TTTTGATCACCAAACCACAGAAACACTACAAACAAAACCGGGGACAAAATTGCAAAAAAA
AAAATCAATTTTTTCAGACAGACCTCGAGTCGCCTGGATGTCGGACCTCATCAAATCCCT
GCCACCATTTGCGCAGGGGTATCGGGCTGAGAAGGTAAGGCGCAGATAAACATTGGACAA
AAGTCGCCCGCTACCGCCCCCGCTACCGCCCCGCTATCGCCCCGCTACCGCCCCGCTATC
GCCCCGCTACCGCCCCGCTACCGCCCCGCTACCGCCCCGCTACCGCCCCGCTACCGCCCA
CTGACACCCCGCTACCGCCCCGCTACAGCCCCGCTACCGCCCCGCTACCGCCCCGCTACC
GCCCCGCTACCGCCCCGCTACCGCCCACTGACACCCCGCTACCGCCCACTGACACCCCGC
TACCGCCCGCTACCGCCCCGTTACAGCCCCGCTACCGCCCACTGGCACCCCGCTACCGCC
CGCTACCGCCCACTGACACCCCGCTACCGCCCACTGACACCCCGCTACCGCCCACTGACA
CCCCGCTACCGCCCGCTACCGCCCCGCTATAGCTCCGCTACCGCCCACTGGCACCCCCGC
TACCGCCCGCTACCGCCCACTGACACCCCGCTACCGCTCTGCTGACCGAAATACTTTAAA
TGCGCATATCTCGGCGGAGATTAAAGGTAACAAAAATTTGTCAACTGACAAAATATTCCA
AAATTTTCAAATTAAATTTTCAGTTTGTCCCAAAGTACAAACTATCGGGATGCACCATAA
ACGGAAACTTTCCCGAAATGAATACAGCCATATTTTGCTATTTGTACAATTCAACGCTAT
ACACTTCGGCGAATAAGACAATTTCTCAGGATATTGGAGAAACTGGGTAAGAATTTTATA
AGTTATCTAGGTGCTCTACAATTAGAGATTCAGATTATGCTCCAAAATCGCTGAATTCAA
TATGAACGACTGGAAGCTGTGGGATAAAATTAATGACGATTTTCGAAGGATTGTATTTAT
TCAGCATCCGTTGGAACGATTTGTTAGGTCATATAAGAAGTTGTGTAAAATGTGAGTTTT
ATTGATTTTTACGAAAAAAAAATCAATAATTATCGATTTTTTTTTTGCAGTGAGCGAAAA
TGCTTCAACTGCCAGGACAATCTCAGTTGCTTCATGCGGAAATTGTTGAAGCAGCACGAA
AAAACAGCGGAGGGGCTTGCAGGACCAGTCAGGACGTTTATCACAAATCATTTCAGCCCT
CAGACTTGGTAAGTACGGTATTTTGAAAAAAGTCGGGAATGCAAGCGCGCTCCATTGCAA
ATTAGCTGAAAATTTGGAAAATTGGCTTTAAAATCGATTTTTAAGTTGAAAGATTAGAAA
AATAGCTGGAAAATGAAGAGAAACGTTCAAAAAATATGTAAAATATTTTAAATTTAAAGA
AAAAGTAAAATATTAGTGCACTTTTGGAGAAAAACTACTAAAATTTCATCAAAAATTCGT
AATTTTTTATTGTTTCCCGTCCAAAAAGGTTTTATTCTCACTTTTTATGCCAATAAAAAA
CCAAAATTTGTACTGAAAATACCAAAAAACCACATTTTTAACATCAATAAATGCAATTTC
CCCTTTAAATCACCTCCCCCACGCTGCGTTTCCTCCTACCACACGCTCTCTCCCCGCAGC
GTCCACGTAAAACATAGCGCGCCGCGGAACCCGCAAGTTGTCCGCCGCGTCGGTTTATTA
CGTTCGCGAGCCTTCTTTCTTTAATCACGTCTGGTGAGGATGAAAACAGGACAGGTTTCG
CTAAAATATTACCGAATGCCAATATGTCGAGACACCTTGGCTGTCTGAGGACGTTTTAAT
AATAAATTTTGGAAGTTAGCTTTTTAGCAAAGTGTGTTTATTATTTCCAGGAATTGCCAT
TTCAATCGGGAGTTTCAAAAGATTCGTACAGTGAAGATTGGCGGGAATCAAACTGAACGG
GCGGAGTTCTCCGATAACCTGAATGAAATCCTTGGGGAGCAGGGAGTTGCTCAAGAGGTT
CAGCGGATTATTAAGGAGGAAGTTTTGAGTAGGTTTTTTAGTCTGAAGCGTCCGAAAATC
CTGATTTTCAGAAATTCCCCTGGAGCTCTCACCGGACGAACGTGAGCTCGCCGTAGCCAT
AAAACGAGATCATGACGATCTTTACCGACTATTCCGTTATCTGTACGAACACGACTTTAT
CGTGTTTGGATACCCATTTTAAACAAGTTCTCAAAAAAAAAAAAAACCAAAAGCAGCTGA
CATTTCACGGGTTCCCCATTTCCATACTTTTTGCGTTGTTGTTCCATCGATTTCTGGTGC
TTTTCCTCAATAAATGATTCGAATTTTGAATTTTAAGGTTTATTTCTTATCAAAAATGAC
ATAATCACTATCAATGTTTGTGTTGTGCTGTGTGGGCTTTTTCAAAACGTTTGGGAATTT
GATTTTTACAAATAGTTCAGGTTTACTATTCTAAAGTGCAACACGGTTTTGCAGAAGATC
AACATTTTTGCAGAATTTTTTGCGGAGGTTTTTTAATGATGTAGAAATTTTAAATTACTG
TAATTTTGTTCATTTTTGAGGTTTAGCAAATGCGCTCTAATGCAAAATTTTGAAATTTTT
GTTAAAACCCCAGCTACTTGAGACTGTTGTAGTTTTTTAAAATTCAATTTTTAGCACTTT
GCTAATTTTCAAATTTTTTTAAAATCAACTAATAGACAATTTCAAGTACTACAATTAGTT
AAAAATTAATGGCCAAACTAGATATTTCTAAATTTTTTAAAATCGTAGATCAAAAATGCT
CACGGAGCAAAATGCTCCTCCCAGTACTGTAGCCAAGTGTCTAGCCAAACAAAATAAGGA
ATCAGTTTGAAAATCAACTGATATTATCAGTTGACATGTGCACATTTTTCTCTATTAAAT
TACCACTATACTACACTTTTTTTCCGTTTTTAAGGAAATTTTTTGATATGCATTAATTCA
CAGAGGTTCAGTATTTTGAGTGTAGTTGAAAAAAACAAAATTTTTTCAGTATGAAAATTT
CAGTTTTTAATTAAAAAAAATGAAATAAAATTTTTTTGAAATTTTTTTCAGATTTTTTCC
AAAAAATTTATTTAGTTTTTTTTTTTTAACTTTTTGAATATTTTAACATAAAAACTCTTC
AATTTCACTGTTATATTATATGGTTAATTTTAATTTTTAAATATAATTTTAAAATTTTCA
GA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1259, 1817..1893, 2483..2625, 2673..2810, 2870..3007, 3650..3807, 3851..3981
1001..1259, 1817..1893, 2483..2625, 2673..2810, 2870..3007, 3650..3807, 3851..3978
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved