Caenorhabditis_elegans Locus top-2
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans top-2
Caenorhabditis_elegans
top-2
II
K12D12.7, K12D12.8
2400..2460, 2475..2546
7432
CACGAAAAAGGTTTTTGATCACGTCCTCGTTGATGAATGTGCTATTGAGGAACTTGCTG
ATACGTTGAGGAATATCCTCTCGGTCCCATTTTAGCATTTGGCGCATTGTTGCGATTAGG
AGCCTGTGCGCATCATAGTAGCAAACGACAGCGATTAATCCTCTGTTGAGGCCTTCGAAA
TGTATTTTTTGAGCTTCTCCGGCCAAAATCAAATCCACAGCTTCCAGCTCATTTAATTGA
AAGATATCCGACAAAATGAGTGCTTCCGAACAGATTTCCTCGTCTAGCGCAACTTCCACT
CCTGCCATTTCCACATTTCCTGGCTTCAGCTTTTCCCGATCTTTACCCGTTCGTCTCTTC
AATTAGAAAGGTTTATTACACTAACATCAGTCGGAAAACATACCGGATTCAAAAGAATAT
TGCTCAATCGCCATCTGTATTTCTCGATTTCGTTGAACAGCTCGTTTATTTTTCGGTCGT
CATCGAAAGCTGTGAAGGAGACGATGAGTTCGTAAAATTTACGAATCTCAATCCACATTT
TGAGCTCTCTAAAATAAATAAAACATTATTTAGAACAAAAAGTTACTTTTTTTGAATTTT
TTCGCAAAAAAATTACACAACTTCTATCTCGCAATGCATTTCCGTAAGAGACGCAGACAC
AAAAACTAAATTTCGTATTTCGAGGCTACAACTACGGTAACACTCGTTTCAGCTGTGTAT
TTTTCGCGCGTTCGCTGCGAGACCCGACGCTCTTAGGCCGCCAATTTCGAATCGGACGCT
CATTTTGGCGCGCTCAGTTGTTTTTTTGTGCGCTCTCTAGCCGGCTGTCTTGCATCGATT
CAGTGTTCAGTGTCCAGTGATGTCCACTGGTGTGCTAGTTCTTTTTCTCTTCACTCATTT
TTCTTCGCATCCTCAAGTTTATTGAATATTCACCGCGTTTCTTTCTCTCTTTCTCCCGAT
CGTCCTAAAATTAAATGTCATCTTTTTCCAGATCTCTAACAATGAGCGACTCTGATAGTG
AATTCTCTATCGAAGATTCACCCAAGAAGAAAACCGCACCAAAGAAGGAGAAGGCGTCAC
CGAAGAAAAAGAAAGATGATGGTTGGTTAATTTGTAGAGTTTCTTGAATCTAATTTGCTT
CTTTTCAGCCAACGAGTCGATGGTTATGACTGAAGAGGACCGCAATGTGTTCACGTCGAT
CGACAAAAAAGGTGGTGGCTCGAAACAAATGGCGATCGAGGATATCTACCAAAAGAAGTC
CCAACTCGAGCACATTCTTCTTCGCCCGGACACCTACATCGGTTCGGTCGAGCATACCGA
GAAGACGCCGATGTGGGTCTACAACATGGAGGAGAGCAAGCTGGAGCAGCGTGACATCTC
ATACGTGCCGGGACTCTACAAGATTTATGATGAAATTCTTGTGAATGCCGCTGACAACAA
ACAGAGAGATCCGAAGATGAACACAATCAAGATCACCATCAATAAGTAAGTTTAGACCGT
AGCATAAAGGAATTTAATTTAATTTTGCTTTCTTTCAGGGAGAAAAATGAGATCTCTGTC
TACAACAATGGCAAAGGAATCCCAGTCACTCAGCACAAAGTGGAGAAAGTCTACGTCCCA
GAGCTGATTTTTGGAACTCTTCTAACATCTTCTAACTACAATGACGATGAGAAGAAAGTG
ACGGGAGGACGCAACGGATATGGAGCAAAGCTTTGCAACATCTTCTCCACAAAATTCACT
CTGGAGACGTCTTCACGGGATTACAAAAGTGCATTCAAGCAAACGTGGATCAAAAACATG
ACGCGTGATGAGGAGCCGAAGATTGTTAAGAGCACCGACGAAGACTTCACGAAGATCACA
TTCTCGCCGGATCTGGCAAAGTTCAAGATGAAGGAGCTGGACGATGACATCTGCCATTTG
ATGGCTCGGCGTGCGTATGATGTGGCTGGATCCAGTAAAGGAGTCGCCGTGTTCCTCAAT
GGAAAACGAATTCCAATCAAAGGATTCGAGGACTACGTCCAAATGTACACTTCGCAGTTC
AACAATGAAGGAGAACCCCTCAAGATCGCATACGAGCAAGTTGGAGATCGTTGGCAAGTC
GCCTTGGCTCTTTCGGAAAAAGGCTTCCAACAAGTGTCATTTGTCAACAGTATTGCTACC
ACAAAAGGAGGACGGCACGTGGACTACGTGGCTGATCAGATGGTCGCCAAGTTCATCGAC
TCGATCAAGCGGAAGCTCACAAAGACGTCGATGAATATCAAGCCATTCCAGGTAAATTTC
GTCGAATTTAAAATATTTACCGCCAATGATGACTCAAAATAGCTATATGAACTCTTTGGT
GACTCGATAATAAGAGAAATCTGAAAATTTTCAAGGTTTTTCTAGAGATTTCACCGATTC
TTTTGAAGTATCGGTGCACCAAGTGAAAAATAAAATTGCGACGCTTTAGTGACGCTGGAG
AAAGTTTTTATCCAGTGTCTAAAGGCGCGGCGCAACATTTTTAAACTTTCCGATGATTTG
TGATTACTAAAAGGCGAATCTGAGGCGAGGAATTGCTAATGCGAATTCAAATCTAATAAA
TTTTCCAAATATTCAATTTTATATCAAAATTTTCAGATCAAAAATCACATGTGGGTTTTT
GTGAATTGCTTGATCGAAAATCCGACATTCGACTCCCAGACGAAAGAGACTATGACCCTG
CAGCAGAAGCAGTTCGGATCGACCTGCGTCCTCAGCGAGAAGTTCTCCAAAGCGGCTTCA
AGTGTTGGAATCACCGATGCTGTTATGAGTTGGGTTCGCTTCAAACAAATGGACGACCTC
AACAAAAAGTGCTCCAAGACGAAGACTTCCAAGCTGAAGGTAACAATTCATCTAATTCGT
GGCCTTGTTTTAATTAATATTTATTTCAGGGCATTCCAAAGCTTGAAGATGCCAACGACG
CTGGAACCAAAAATTCCCAACAATGCACATTAATTCTGACGGAGGGAGACTCGGCCAAAA
CGCTTGCTGTTTCGGGACTTTCAGTCGTTGGACGCGACAAATATGGAGTATTCCCACTTC
GAGGAAAATTGCTAAATGTCCGAGAAGGAAATATGAAACAAATCGCCGATAATGCTGAGG
TCAATGCCATGATCAAAATTCTGGGACTCCAATACAAGAAGAAGTACGAGACAGAAGATG
ACTTCAAGACTCTTCGATACGGTAAACTGATGGTCATGGCTGATCAGGATCAAGACGGTT
CACACATCAAAGGACTCGTGATCAATTTCATCCATCACTTCTGGCCTTCTCTCATTCAGC
GGAACTTCGTAGAAGAATTCATCACTCCAATTGTCAAAGCCACCAAAGGAAAAGAAGAAG
TTTCCTTCTATTCGCTCCCAGAATATTCTGAGTGGAGAATGAATACGGATAACTGGAAGT
CGTACAAGATCAAGTACTACAAGGGATTGGGTACATCGACTTCTAAGGAAGCTAAGGAAT
ACTTCTTGGACATGGTTCGTCATCGTATCCGCTTCAAGTACAATGGAGCTGATGATGATA
ACGCTGTCGACATGGCTTTCTCGAAGAAGAAGATTGAAGAGAGAAAAGACTGGCTCTCGA
AGTGGATGCGGGAGAAGAAGGACCGAAAGCAGCAGGGACTTGCTGAAGAATATCTCTACA
ACAAGGACACTCGATTCGTCACCTTCAAAGATTTCGTCAATCGTGAATTGGTCCTCTTCT
CGAATCTCGACAACGAGCGTTCAATTCCATGCCTTGTGGATGGTTTCAAGCCAGGACAGC
GGAAGGTTCTCTTCGCGTGCTTCAAGAGAGCAGACAAGCGTGAAGTCAAAGTAGCTCAAT
TGGCTGGAGCTGTCGCTGAAATTTCTGCTTACCATCACGGAGAACAGTCGCTTATGGGAA
CAATTGTGAATCTCGCTCAAGATTACGTTGGCTCCAACAACATCAACCTGCTTCTTCCAA
TCGGACAGTTTGGTACTCGTCTCCAAGGTGGAAAGGACAGTGCTTCAGCTCGTTACATCT
TCACTCAACTGTCGCCAGTCACTCGTACACTCTTCCCGGCTCACGATGACAATGTCCTTC
GTTTCCTTTATGAAGAAAATCAGCGTATTGAGCCAGAATGGTATTGCCCGATTATTCCAA
TGGTACTCGTCAATGGAGCTCAAGGCATCGGTACTGGATGGTCCACGAACATTCCTAATT
ACAATCCACGTGAACTGGTCAAGAACATCAAGCGTCTTATCGCCGGCGAGCCACAGAAAG
CCTTAGCTCCATGGTACAAGAACTTCCGCGGAAAGATCATTCAAATCGACCCGAGTCGAT
TTGCATGCTATGGTGAAGTTGCTGTGCTGGATGACAACACCATTGAGATCACCGAGTTGC
CAATCAAACAGTGGACTCAAGACTACAAAGAGAAGGTTTTGGAAGGATTGATGGAGAGCT
CGGACAAGAAATCGCCTGTTATCGTCGACTACAAAGAGTATCACACAGATACAACTGTCA
AGTTCGTCGTGAAGCTCTCGCCGGGAAAACTTCGTGAATTGGAGCGCGGTCAGGATCTTC
ATCAAGTCTTCAAGCTCCAAGCTGTCATCAACACTACGTGCATGGTACTTTTCGATGCTG
CCGGATGTCTTCGTACATACACTTCGCCAGAAGCGATTACTCAAGAGTTCTACGATAGTC
GCCAAGAGAAGTACGTACAGAGAAAGGAGTACCTTCTCGGAGTTCTTCAGGCTCAGAGCA
AGCGTCTCACTAACCAGGCTCGTTTCATCCTCGCCAAGATCAACAACGAGATTGTTCTCG
AGAACAAGAAGAAGGCGGCGATTGTCGATGTTTTGATCAAGATGAAGTTCGATGCTGATC
CAGTGAAGAAGTGGAAGGAGGAGCAAAAACTCAAAGAGCTTCGTGAATCTGGAGAGATCG
AGCTGGACGAAGATGATCTAGCTGCTGTCGCCGTCGAAGAGGACGAAGCCATTTCCTCTG
CTGCGAAGGCCGTTGAAACCAAGCTATCAGACTACGATTACCTTGTCGGAATGGCTCTCA
TCAAGCTTTCGGAAGAAGAGAAGAATAAGCTCATCAAGGAATCGGAGGAGAAGATGGCTG
AGGTTCGAGTTATCGAGAAGAAGACCTGGCAAGATCTTTGGCATGAGGATCTGGACAACT
TCGTGTCTGAGTTGGACAAACAGGAGGCTCGCGAGAAAGCTGATCAAGATGCCAGCATCA
AAAATGCCGCCAAAAAGCTTGCTGCCGACGCAAAGACCGGACGTGGACCCAAGAAGAATG
TGTGCACGGAAGTCCTTCCATCCAAAGATGGACAGCGCATTGAGCCGATGTTGGATGCTG
CAACCAAGGCCAAATATGAGAAGATGTCTCAGCCAAAGAAGGAACGCGTCAAGAAAGAGC
CAAAGGAGCCGAAAGAACCAAAGAAGGTGAAAAAGGAAGGCCAGGACATTAAAAAGTTCA
TGTCTCCAGCTGCTCCGAAGACTGCGAAGAAGGAGAAAAGCGACGGCTTCAACTCTGACA
TGTCAGAGGAAAGTGACGTGGAGTTCGATGTAAGATTTCCTCTGTAATTTCTTCAACTTC
TAAAATATTTTTTGCAGGAAGGAATCGATTTCGATTCGGACGATGACGGTGTGGAGCGTG
AGGATGTCGTCTCAAAGCCAAAACCTCGTACTGGAAAAGGAGCTGCGAAAGCGGAAGTTA
TCGATTTGTCAGATGATGATGAAGTTCCTGCAAAGAAGCCTGCTCCAGCGAAGAAAGCTG
CTCCGAAGAAGAAAAAGAGCGAGTTCAGCGATCTGTCTGGCGGCGACAGTGATGAAGAAG
CTGAGAAGAAGCCGTCCACCAGCAAAAAGCCGTCTCCAAAGAAGGCTGCTCCGAAGACGG
CCGAGCCCAAGTCGAAGGCGGTGACCGATTTCTTTGGTGCTTCAAAGAAGAACGGAAAGA
AGGCCGCTGGTTCCGATGATGAAGACGACGAAAGCTTCGTTGTGGCTCCAAGAGAGAAGA
GGTTAGTTTGAAAATTATTTTTAAAAAATGTAATTATTTCAGCGGAAGAGCTCGCAAGGC
GCCACCAACTTACGACGTGGATTCAGGATCCGATTCGGATCAGCCAAAGAAGAAGAGGGG
ACGCGTCGTCGACTCCGACTCGGATTAAATTAATTTGTTTCCCACCTTCCTTAAGTGTTT
CTAATTTATTTTCTTTCCAATCATTTTAAAATCGTTTTAACGATCTCAACCATCCCCATC
CTCCCCCAAATCATCCCGTATATTAAGTTTGTATTTTTACATGAGGGAAACTGCTGTAAT
ATAATTATCGCCCTTATGCCTAAATTATTTACCCCTACCTAATTTCACTGTTTTTAAAAG
TTATTTTTCTATTTATGTGAGTCTCAAGAATTATTGAGAAGAGTCTTCTTGCAATGAAAA
TGCCTATATTTCCAAAGCTTCCAACCTATATGCAGGTCTTCATCGTTTGTGTCGCTTGAG
AAATGACGATGACAAGTCGTAAACGGTCTGTGTCCTTCTTCGTTGCATCCAACGTCTTGT
TCCTACTGTTTTCTATTCCCCTATCGATCACACACTGTGTGTGCGTGTCCTTGGGCCTCT
ACCGTTTTTGAGGTCGAACATTTTAGACATTCAGGCGAACAATGAGATTTAGAGAGACAC
ATGGAATCGCCTCCCCGGGAGAACTGGAGACTCGAGATGATTTGGTAGTCAGATAAGAAG
AATCAATTGTATATTGAAGAAAAATGTAGAAATTAGGGAAACTTTTAAAGATAAAATTTA
AAAATAAAATGCATTCGGCGCCAAGCTGAATGTGTCTCTAGTCATAGTCCTTGCTTTGTG
GAGGATATTATGACTAACGAGCACATCCAGCGTGGCACATGGTGCATGAGCAGCTGAATA
CTGGAACGAAATTTGAATAAGTTGATTCTCAGAAGTTTGGCCGATGGCGGTATCGAGTGA
AAGGGTCAAAAGGAAATGAATGTCAAGAGAGAGAGAGAGACCGACCTGTTTGAGAGAAGA
AGGAGAAACTGGGCGGGGTTTTGGTAACAGGGGAAAGGATAAGGAAAAAGTTGGAGAGTT
TGGGGTGAAGGTGAAAATAGTCGAAAGTTGAGAGGGGCGGGGCATCGTGTCTCGAGAAGC
TGGAAGATTCTGGAAAATCTGAAAAAAACACCTTTTTTAAAAAGGTATTCCGTGATCGTG
GCAAGACCTGGGAAATGGGAATTATATTTTAGAAATGTACAAAAAAATCGTGGCGAGACC
CACCAAGGTTTTTACAATATAAAAATATCAACTAACTTTGAATTCGCGGAAAAAGTCAGT
TTTCAAAAAAAAAACTACAAATTCTCGTTTCCATTACTTTTCAGAAATTAGCTATACAGT
AGAGAAGGCGCTCACGAAACTTCTCAAACGTAGATCAAACCAGGGGTGGGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1100, 1148..1484, 1538..2270, 2616..2858, 2909..5548, 5597..6000, 6042..6432
1001..1100, 1148..1484, 1538..2270, 2616..2858, 2909..5548, 5597..6000, 6042..6144
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved