Caenorhabditis_elegans Locus mdt-8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans mdt-8
Caenorhabditis_elegans
mdt-8
II
Y62F5A.11
2521..2666
8574
GCTTAACAACACGCGACGCGTAACATCGGAGCATCGTTGTATTGTTTTCTTTGAGAAAA
ATAGCGTTTGGCACAGTGCCAGATCCCCTTTTCGTTGCTCCCCTTTTCGTATCTCCCCTT
TTCGTATCTCCCCTTTTCGCAGATCCCCTTTTTGCAGATCCCCTTTTCGTTCTGCTCCCC
TTTTCGTGGGGCCTCTAATATTTTGGAGGAAAAAGTGGAAAACCGGAAAACAAGTCGAAT
TTTCGCTTCAATTTATTAATTTTTCTCCTTTTTTCTTGCTTATTATTGTTTAAAATGTTA
ATTTCTGCTCCAAAATTATTCTTGAATCAATTTCAGACATGGATCTTGCGGAGGATTGCA
ATAAATTCCAGGAATTCCTTCGCCCTTCCACGGAAACTCACGTTCCGCTGCCACCGAACT
TTTACGAGTCGTTTTTAAGAAAAAATCCGAATTACAATCCACAAATGGAAACGCCAAGTG
CTCCGAGCACGCCGAACACAAGCTCGAACTCAATTCCCAGTGCTAGTGAGTTGTTTTTTT
GAATCAAAAACGTTATTTTACTTTAAAAAATTCAGCTATTTTCAGGAATTCCAAGTGGAA
ATTCAAACGCACAAGTTGTGAAAGCGCTTCTCGAGACGAATAAGCGGTATATCGAACAAG
CCGCAATGCAGAAAGCAGCAAACGAAGTGAATGTGAAAACTGCACAATATAACAATTTGA
TTCCGATTTCATTTGATCAGGAAGAATTTTTGAGAGGCATCGAGGAATCTAGAAGACCGA
AATAACGCTGTAAAAATTATAAACATAATTTTGTAAATACTATTCATGATCAGAACTTAA
AACCTTTCATAATTAACGAATCGGGTTGAATAAATTATTGAATCTCATTTTAAAAAAATG
TTTGATTTTTTATTTCTGCATTACTCATGGTATTGACCACTATTTTTATCTTTATTACAT
GATTTTGTTTTCTAAAATCTAAAATATCAATCCTTGTTCAGATGGAGTATCCAAATCCAC
CTCCTCCGGTGACTTCGAATTACCAAGGCGAGCCTGAGAAAATCGCACAAGCTACGGATA
TGATGATCAAAAGAGTGACGGACGCCAAGAAAATCATCGAAGAGCTCCTACAAATGCTCG
ATTTGCAAGAAAAGTGCCCGTGGCCGCTGATGCTCGAAAAGTTTTCCACGTTGGCATCCT
TCATGTCGAGCTTACAGTCATCGGTCCGAAAAAGTGGAATGCCTCACGGCCACGAAGATT
ATGGGCAATTCCTGAGATCTCATGTACTTGTGACACAGAGATTGCAATACGAACCAGATG
AAACACTTCAAGTAAATTTTTTTATTTTTAATTGTTTTTTTAAAATTTAACCAATATTTC
AGAGAGCTACTCAAGGACGTGTGATGTCATGGAATCACGCTCTAGTTCCAGAATATTTGA
GAACAAAACCGAATCCAGAAATGGAAAACGAAGAAGGAATGCTTGACGGCGAGAGAAGTG
CGAAGAGTGCGGATCTGGTGGTCAGACAAATTGCCGCGTACAACAAAAATATCGAAGGAT
TGATTAATCATTTGAACAGTGTTGATAGGATGCACACGGAAGCTGCCATTGAAAAAGTGA
ATTTTATATCAACTCAAAGTTGACAAAAATATTCAAAAAATGCACAAATTTGGTTCTGAA
AAAATCTGTTTTTATGTTCTGGAACATTATTTTTTTGATCTCTCACTCGGCATTCAGAGG
CAACTTCCTGCCACACTTTGGCAACTTATTTAGTGCCACTAAAATAAGTTGCCGAATTGC
TGGCAGGAAGTTGCCGAGTTGTTGGCAGGAAGTTGTCGCGTAGTGGCAGCAAGTGGGAAA
AAACGCTCCTCGGCATTCAGAGGCAACTTCCTGCCATTTTATGGCAACTTTCTGCCAAAC
TTTGCTTACTTGCAACTTCCTGCCAAACTTTTGCACATTCCTGCTAACATTTAGATGTTT
CTGAGCGTTTTTTCCCACTTGCTGCCACTACGTGGCAACTTCCTGCCAACAACTCGGCAA
CTTCCTGCCAGCAATTCGGCAACTTATTTTAGTGGCACTAAATAAGTTGCCAAAGTGTGG
CAGGAAGTTGCCTTTGAATGCCGAGCACAGAGGAAAACAAAAAACGGCTCCAACCGAGCA
GAATTTAAAATTTTTTAATTGCAGGTTGAAATTAAACAAAAAAAAGTACCAAATTTTGCC
AAAATATAAAATAAATTTAACTTTTCCTTGTCGCGGTAACTTTAATATAAATTTTTGGAG
TTATCATCCTGCATTACATTTTTCAATAGTTTATCTTGTTTTAATAAATTTATTTAGATA
GATTTCAAGTCAATAGGCATTCAATTTTGCTAATTTTTGCCTACAGACTTAAAATGTGCC
TAAATCAACGAATTAATGCAATAAAAACTATTTAAATATGGAATAAAAAGTTCGCTTGTT
TTGGCTTCTGCTTAACCAAAAACCCAAAAACTCTCCCAAAGTAAAAATTCGAATTCCTCT
TCCCAAAATGACGAAACCCTATCCCCAATGATTTTACGACGTTTCAAGTCATTTCCATAT
CAATCGGCGACCTACTACACCGTCTTTTGATTGACCTGAAACGCGTAGAGCTAGTGAATC
TTCATCATAACGATAAGATCTGATTGGAAAAGAGAAAGCGAATGGGACGAAAGTTGGAGA
CGGAGAGAGTTATCTTGATTGCTATAAGCCTGAGAGAGGTCGAGAAACTGAGACGGTGTT
CGGCTAACTGATCAGTGGCCAGAATTGATTGAATCACAGGGAAATGTCGGACGTACAGAA
CATTAATTTCTGTATGAAAATCCAAGTTTTTGAATCAAAAATTAATACAAATATGTAGGA
AAATGATCGACCGATCATTTTTGTTACAGTTTCATATTAATTTTTGATTCAAAAACTCGG
ATTGTCATACGGAAATTACATATTTTATTTGCCACCACAGAAAAATTGAAAAACAAAAAC
ACCAAATTTCAAATTCCAAATTATATGCCAGTCACCGCATAATCCAATTATTTCAGCCAA
CATACAACCGAGACGAGACGGCGAAAATCGTAAAATCAATATTAACTGGAGAAGGAATCC
GATCTCAACGAACAATGGCTCCAGCTCCTCCATCATCAGCCCCAATGACGACTGCACCAA
GTTCAACAGGACCATCGTCTTCCCAGCCGATCAGTGGAAATCAGCCAGAATATCAAGGAT
CACAGCTTCGACAGCAACTCAGTGGAGGTCAACCACAGACATCACAGGCTCATTTGCCAA
TGTATTCACATCATCAACAACCACAATACTCACATCAACAACCCATGAATCCACAACATC
ATTCACCAATGAGTAAGGAATTGTGCAAAAAAGTCTTCCGAAAAATAATTTTCTAAAAAT
TGACAAAAATTCAAATTTTTATTAAATTTTGTCTATCTTGATGATAAAATACATAAGAAA
ACATAGCATTTTCTTTAAAAAAAAAATAGAAAAAAAAAGATTAAAATTTCGAAAAACGAA
TAATAATCCCGATTTTTAGATTATTATGAAAATCGGAAAACGACAAGAAATTTTTTTTTT
GAAAAATTGCTATAAAATTTCGCCATTTTTCCTTTTTTTAGAAGAAAATTATATGTTTTC
TTATGTTTTTTCATCAGCATGTACAGAATTTGAAATTTTTTTTTAGAAATTCCGGAAAAT
CGAAAACCGAAAATTTTTGGTTTTTCCGTTTTTAATTTTCCAGTATTTTAAATTTAAAAA
AAAATCGAAAATTTTTGGTTTTTCAGTTTTTCTGAATTTCTGTTACATCAAAAAATGTGT
AGCAAAAATCATTGAAAAATGCCAAAAATTGGAAACTACCTACAGTACTCTTTAAAGGCG
CACACTCTTTCGAATTTAACAAAAAATTGTCGTGTCGAGACCGGTTTTTTGGAGTAAATC
GCAAAGCTTGCAAACAATAAATCAATCTGATCAACTAAAAAATTGTTCGAAAAAACGTAA
ATTTAGAAAAAAAAGGAATTTATTTTTCAACTCCTCGGCCTTCATTCCGAGATGACAAAC
TTTTTGGTGGCAAAGGTTCTTTGGGGGCATAGTGTCCAAGGAGACAAAGTATCCAGTAGA
CAAACTGGGGTGTATCTTGGGGGGCATATCTTTGGTGACAACCTTTTTTTCAACTAGATT
TTTATATGTATTTTTCAACTAATTTTTGTTCACATTTTTCTGGAATAAGTTTTTTAATGC
AATTTTCAATCGATTATCGGTTATAATTCCCTCACAATTGAATGTATGAACGATGGTCTT
TTGGGAAAAGCTGTAAAACGTCCAACTAACTTGGAATATCGTGAGGCTCTTCCTGATGGT
CTGATCCTTCAGCTCCGAAGGATCACATGGGTACCTTCTGATGTTCTGATCCTTCAGATA
AGAAGGATCGTAAGGGTACCTCCTGATGGTCTGATCCTTCAGCTCCAAAGGATCACGAGG
CTCTTCCTGATGTTCTGATTCTTCAGCTCCGAAGGATCACATGGGTACCTTCTGATGTTC
TGATCCTTCAGATAAGAAGGATCGTAAGGGTACCTCCTGATGGTCTGATACTTCAGCTCC
AAAGGATCACGAGGCTCTTCCTGATGTTCTGATCCTTCAGCTCCAAAAGAACATGAGGCT
CTGCCTGATGATCTGATCCTTCCGATCCGAAGGATCACATGGGTACCTTCTGATGATCTG
ATCCTTCAGCTTCTACCAAATAATGATAAATTCTCCGCGATGACAAACTTTTGGGTGACA
AAGTATCTTGGTGGACAAACAAAAATTACCGAAAACTGATGTAAGGAATAGTGAAATAGA
GTCCTATGGACTATTAAACATGTTCAGTAGGTGTATTCAGGACTGTCCGTCAAAATAAAA
AAAAGTTTGTCAGACGAAGTTCGAACCTGGGACCTGTAGGATGCAAAGTTCGCTCACTAC
CACTACACCAGCTATGCGAAAGTCGGCGAGCCTCATCGAAGGCTATTATAAAACTTAGTT
CGCACGAGTATGATCGACATTCAACAAACAGTAATATCTCTCAACAAGAATTTCTTCATG
GAATTGAGGTCATTTGACTATTTTTATCGGTTTTTCAAGTTGAGCATAGGGTCTTTTAAT
TTTTTGAGCATAGAAAATCATGAAAGCTGCCTGTTCCTTGTATCCTGGATCGAAATAGAC
GTATCTGGCCTAAAATATTTCCTGAAAAGTGATCATTTCATGTCTATCGTGTGTTTCTCT
GTATTTTGAACCAGAAAGTTGAACAAAAATGATAATATTATATCGAAAAATGGAACAAAT
ACAAATAAATTTTAGGCCTAATCAAATTTCCTCCGGATATTGTTTTTTTGTCATGATTAT
ATGTTTCTAAATTTTTTATAATGTGTTTTATAACAAAATTCGTCAATATTTCCTTCATTT
CAAGCAAAATTTAACAGTTCGAGCTGAAAAATAGATGTTGCAAAAAATTTAATTCGTTTC
GATGAATACGGTATACGGTCGGTGTTTGCGTACTTTGGCGTTTGCGTATGAAGCATCCAA
TTTGACGCACGAAACTTTCAATGAAATTTAATGCAAATTCTGCATCGAAAAGGACATTAT
GATGGAAATAATGACGAATTTAATTATAAAACACATTATAAAAAATTTAAAAACATATAA
TCATGACAAAAAAACAATATCCGGAAAAAATTTGATTAGGCCTAAAATTTATTTTTTATT
TTTTTCCATTTATCGATTCAATATTAACATTTTTGTTCGACTTTCTAGCTCAAAATTCAT
AGAAACTCACGATGGACATGAAATGATCACTTTTCAGGAAATATTTTAGGCCAGATACGT
CTATTTCGATCCAGGATACAAGGAACAGGCAGCTTTCATGATTTTCTATGCTCAAAAAAT
TAAAAGACCCTATGCTCAACTTGAAAAACCGATAAAAATAGTCAAATGACCTCAATTCCA
TGAAGAAATTCTTGTTGAGAGATATTACTGTTTGTTGAATGTCGATCATACTCGTGCGAA
CTAAGTTTTATAATAGCCTTCGATGAGGCTCGCCGACTTTCGCATAGCTGGTGTAGTGGT
AGTGAGCGAACTTTGCATCCTACAGGTCCCAGGTTCGAACTTCGTCTGACAAACTTTTTT
TTATTTTGACGGACAGTCCTGAATACACCTACTGAACATGTTTAATAGTCCATAGGACTC
TATTTCACTATTCCTTACATCAGTTTTCGGTAATTTTTGTTTGTCCACCAAGATACTTTG
TCACCCAAAAGTTTGTCATCGCGGAGAATTTATCATTATTTGGTAGAAGCTGAAGGATCA
GATCATCAGAAGGTACCCATGTGATCCTTCGGATCGGAAGGATCAGATCATCAGGCAGAG
CCTCATGTTCTTTTGGAGCTGAAGTATCAGACCATCAGGAGGTACCCTTACGATCCTTCT
TATCTGAAGGATCAGAACATCAGAAGGTACCCATGTGATCCTTCGGAGCTGAAGGATCAG
AACATCAGGAAGAGCCTCGTGATCCTTTGGAGCTGAAGGATCAGACCATCAGGAGGTACC
CTTACGATCCTTCTTATCTGAAGGATCAGAACATCAGAAGGTACCCATGTGATTCTTCGG
AGCTGAAGGATCAGAACATCAGGAAGAGCCTCGTGATCCTTTGGAGCTGAAGGATCAGAC
CATCAGGAGGTACCCTTACGATCCTTCTTATCTGAAGGATCAGAACATCAGAAGGTACCC
ATGTGATCCTTCGGAGCTGAAGGATCAGACCATCAGGAAGAGCCTCGTGATCCTTTGGAG
CTGAAGGATCAGACCATCAGGAGGTACCCTTACGATTCTTCTTATCTGAAGGATCAGAAC
ATCAGAAGGTACCCATGTGATCCTTCGGAGCTGAAGGATCAGACCATCAGGAAGAGCCTC
ACGATATTCCAAGTTAGTTGGACGTTTTACAGCTTTTCCCAAAAGACCATCGTTCATACA
TTCAATTGTGAGGGAATTATAACCGATAATCGATTGAAAATTGCATTAAAAAACTTATTC
CAGAAAAATGTGAACAAAAATTAGTTGAAAAATACATATAAAAATCTAGTGGAAAAAAAG
GTTGTCACCAAAGATATGCCCCCCAAGATACACCCCAGTTTGTCTACTGGATACTTTGTC
TCCTTGGACACTATGCCCCCAAAGAACCTTTGCCACCCAAAAAGTTTGTCATCTCGGAAT
GAAGGCCCAACTCCTCAATTCTCTATATCTCTTGCTTTCAAAGTTTGAATAATGTTGAAA
TAATCAGAGATCAAAAATGCTTCCCACTTCCCAGTGCTCTCTCAGTTTCCCCTCGAAAGA
TTAGTGGTCTCATGATTATGAGCTCACCTCGCACTTTATAAGAGCATCATGACAACGTCC
ATAAGAATTTCAGCAATGATGGCGCCTGGGCAAATGATAGGACATCCGATACAACAACAA
CGTCCACCGATGCATCAGATGCCTCCAAATATGACTATTCAACGACAATGATCTCTTATT
TTTATTTTAAATTTTTATCTTGTATTTTTCTAATTTTATTGAAAAATTTGTGATTAAAAA
GAAGAACAAAACTAGTCTTTGAATAATTATTGAATGGTTTTTCTGTGCTCAGCGTTTCTA
TCGCTTTTGCTTTCTACTTTTTTGTTTTTTTTCTCGAAATTATTCCAATTAACCTGCAAG
CTTTCATTTTAAGATTTTAAGATGTCTATGGGACGAAGCCCCTCCACGACATTTCGAAGT
CGAACCGGAAGCCATGGAGCTCGAGATCTGATTGCTGGACACGGACGGAACTCCCGACGT
ATCTCGCAGATGCATGTTAACATTTTACATCCACAACTGCAAACGATGGTCGAGCAGTGG
CAAATGCGAGAACGGTAGGAAGTGGTGGTCTAGAGTTGTAGATTTTTGAAGTGGGAGCTC
AGTTCTCTCTTGAAATCGAATCGAAACTGGTTAATTTCAGCCCATCGCTGGAGACCGAGA
ATGGCAAAGGATCGCTGCTCCTGGAAAATGAAGGTGTCGCAGATATCATCACTATGTGTC
CATTCGGAGAAGTTATTAGTGTAGTATTTCCGTGGTTTCTTGCAAATGTGCGAACATCGC
TAGAAATCAAGCTATCAGATTTCAAACATCAACTTTTCGAATTGATTGCTCCGATGAAGT
GGGGAACATATTCCGTAAAGCCACAGGATTATGTGTTCAGACAGTTGAATAATTTCGGCG
AAATTGAAGTTATATTTAACGACGATGTAGGTTATAATAATTTCATTAAAAAACCAATAA
TATATCTACTTTTTCCAGCAACCCCTGTCGAAATTAGAGCTCCACGGCACTTTCCCAATG
CTTTTTCTCTACCAACCTGATGGAATAAACAGGGATAAAGAATTAATGAGTGATATAAGT
CATTGTCTAGGATACTCACTGGATAAACTGGAAGAGAGCCTCGATGAGGAACTCCGTCAA
TTTCGTGCTTCTCTCTGGGCTCGTACGAAGAAAACGTGCTTGACACGTGGACTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1330, 1382..1615, 3056..3371, 7453..7574
1001..1330, 1382..1615, 3056..3371, 7453..7547
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved