Caenorhabditis_elegans Locus T06D8.3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T06D8.3
Caenorhabditis_elegans
T06D8.3
II
T06D8.11
2871..2947
6209
AGAGCCGAGGTTGGTCTAGGACTATTTACTACAGTATTATGTTGAGTTTCACCCTGCTA
TTTTGCTAAAATGATATCAAAGTGAAACTTTTCAACTTTTTTTTAACTAAAAAAGGGTAG
ATACCCCAATGTTTGCCTTTTTGGAGGTCGACCAAAATAAGGTTTTTTTTACAAATTATA
TATTTTAATTATGTTTTTAAAATTTGTATTTGAACAATGTAGGGATTTAAACAACTCTAA
ATTTCTTTAAAAATTCCAGCCTTATCGTAAATTTTGCAAGTTGCGAGAATTTTGACATAG
TACTTTTGGACCGTTCCAAGTGTATTTATTAATTCCAGACTAGATGAGATTTTATTACAG
TTTATGCTAAACTAAAATAAATTATAGCAACTTTAGGTTGAACTCTAAATTTCACAACTC
ATATAAGTCGTCTTTTAAGCCATTTTGTAGAATTACAGAAAATAATTTTTCTCGGCATTT
TATTATCACGTTCTAGTTCATTCCATTTGTAACACAAAAGAAACTCTACGAAAAAAATGC
ATAAGTCATTTGTAAATCGGAGGCAGCGCCAGCTTCTTCTCTACTTGACTTGTTTACCCA
TCACGTACGGTACGCAGCCTGAAGCGCGGAGCCCAACGGAGACGCAGACTGGCTAGTTAT
ACCGTCCGCCTACCTGTCTCCGACCGTCGGGGGCGAGCTCACCGGAGAGAAGAGCATCCG
CGAGCACCAGCACACACACACCCCTCTCCCCCTAAGAACAGTTAAGCATCGATCGATCGG
ATGCTCATGATTCTCAGGAAGGGACACACCTTGGGACAACATCACTTTTTTCAATTTTTT
GAAATCTGACTCATCACCTGGGAGTATTTTTTTGCCCATCCTATCTTGTCATACATCCTG
TCAATATATTATAAATCAACTCTTACTTTCTCCATTTTTTTCGAATTTTGTTTTCGACGA
TTATTTGTTGATATTATTTTTTCTTACGTTCCAGAAATCTGAAAAACGACAAAATTACGA
AAATTCCGGGGCGCAACGACATGTCCGTGCCAGCTTCGCGGGCACACTCTGAGGTAAGAA
ATGTTTCGATTTTTACTTAAAAAATACTGTACCCGGTCTCGAAGCGACAGATTTCTTTAC
ATTTCAATTCAAAATAACGTGTGCCTTCAAAGTGGACTACTGTAGTTGCTAACTCTTTGT
TGTTGCAAATTCGCAAAGTTTAATTTTTTTTCCTATTCATTCCTCAACGATTCTTCAAAA
CGTAATTTTCAAAATTAAAAAAAAACAAAGAAAGTTCCGCAACATCAACAGAAATTAGAA
ACTACAGTACTCTTTAATGTATGATGAAAAAATCGGTCGCTGCGAGACCTGGTACCGTAT
ATTTTGTGCCAAAGTGACAAAATTTAATGTCTGGTTTATAAAAGTTTACAAAAACTTCCC
AGTTATCAAAATTTGGGGTACTCGGGCTTTCAGATTACCACATATTTTGAGATGAGTGAT
TCTGAAAGCCGTATGCCTCAAAACTTTATTATGCTTCCGTAAATTATGACTTTTTTTTAA
ATTGTAGCAAATTTGATGCTCAAACTCTACACTTCCCTCAACAACATCCCCTTTCAGGTG
TTCTCGGCGAGCCAATACGGAGGTGTGACCACAGTTCCCGCACCACGACCCCGCTCCTAC
ATCAACTATTTCATTTTTCCATCCGCAGTCCTTCACGTCGTCGGAATTGCGTGTCTCGCC
GCACTTTGGTACTACTTGAGGTAAGCCTTTGACAGTTCCTTATTATTACTATTATTTTCG
TTGTGATTGACAGATTAGGTACGGCAAATATATGTAGGTTAAGGACAGGAGAGAGAGTGA
GAGAAGTTATTGTTTGTACTATGATTTGCTCGGCGAGCTATCGAAATTACTCAAGCTCGG
TTGACCTTTTGGTGATTAGAAATAGTGTAATAGGATTTATAGAAACTTTATTATTAACAT
CATATGAACATATCTGTGAAATTTTGCACCTTCAGCGATCCTTATGACCTAGATTGTGGC
GAGATCCATTCCAATAAACATCGTGTGCCTTCAAACTTTTCTCACGAAACTACAATAATC
AATTAAAACTTTACTATTTTTGCAAAGCTCCCGGCTAATTTTAAACAATGTAAAACAAGA
AGTGTTGCGAAAATAAGGTGGGGGTCAGTCGTGGAAAAAGCTGTGCAAATATACTTTGAC
CCATTTTGGAAGCTTTTCGCATTGTCTCATCTCTTCACCTTTAATTGTGTGTTGCCGAAA
ATAGACGAGAAAAAATATTTAAAGAAAGAAATATATTATGTTTTATTATCTTATTTCATA
GTTTTCGCGATTTTAGGCCATAAAATACGGTCCCTGGTCTTAATGCGACATTTTTTGTTT
AATAGAAACGGGTGTGCGCCTTTAAGGATTACTGTATTTTATAACTTTCATTGTAGTGGA
ATTTTCATCGATTCTTAATAGTTTTTCTGACGATTTTTGAAAACTTATAAGGTTTTAAAC
GTTTTACTTTAGTTTTTCCAATTAATAAATATTATTCTAACGAAAAACTATTCAAAATCG
ATGGAAACTCCGCAAGCTTGAAGCCACAGTACTCTTTAAAGGCGCACACTTTTTTATTTT
AATTTAAAAAAAATTGTCGTGTCGAGTCCATTCACCATAGGTTTGGAAAATTAGCTTAAA
ACTATCACAAATATCAAAATCCCCCTCAAAACTGAGCTCAGAACTCCAAAAAGTTGCATC
CCCTTCTTCTAGTGGGCGGAGTCCTGTCCCACAGATACCACTGCGATAGGCGAAACTCGC
AAGGTGTCCGCCGCGCCGTCTAGTGTACCCAACAAGTGTGCCTCTTATTTAAAGCCGATG
ATTACCAAAAATAACCAAATGTTTGAGTGATTGTTTGTGATCGAATTTTGTCACTATCGC
TGAGGCTTACAAATTTTGCGAAGAAAATCAATTTTGGAATAATTCCTCTGAAGGATTCAT
GTAATATTTTCAGGTTCACCAGTGTCTTCCCTTACCATCATCGGGTATTTTACTGTCGAG
ATGTTCACCTCTACAAACCAAACTTTGTACCAGAAGATTTCAACGTCTACGTTTCATATC
CTCTACTCTACACACTTGCCTTCACAATTCCTCCCCTAGTTATTCTGATCGGTGAGGTGA
TGTTCTGGTTGTTCAGCACAAAACCTAGGAAGATTGTCTACGCGAATTGTGGAGAGTGCC
CAGTTCACTTGTTCACCAGAAGACTCTTCCGTTTCGTCATCATCTATCTTGCTGGTCTCC
TGATTGTTCAGATTTTTGTTGACACGATTAAGCTGATGACTGGATACCAAAGACCGTACT
TTTTGTCCCTTTGCAATGTTTCTATAACGTAAGACCTTTAGAGCATAGTTTATTGTGAAA
CCTAGTATAATTATATAATTTCAGCGCCTGTACTGCTCCACTAGAGCATTCACCATCTCC
ATCCCCTCATTTGGCCTGCAATTACAGGTTTGTGATAAAGGAGAAGTTATGTCAAAATTA
TTTTTGTAATTTTCAGAGGAGCTGATGAGCTTCGTTACGCATGGCTCACGTTCCCATCCC
TTCATGCCGTCGTCTCATCGTACGCCGCTTGCTTTGCATCTGTAACTTGCAAATTTTTAG
TTTTCAAAATTTAAAATATATGGGAAAAGTTTGATCAAAATGCCATGCTCGGCGTTTTCA
TTTCTGCTTCAACACTAAACAAAAAAATATTTCAAATATGTTAAAGGTTGTCTAAATAGA
GCCCGGGTACCCCCAAAGAATCAAAAATTCGATCATTGAAATTTAAATTTTCAAAATTTA
ATTCTCTCCAGCTCTACATCTACTACATGATTAACTTGCGTGGAGCCCCACTTCTCCGCC
CACTCCTTATCTTCGGATTCATGGGACTCTGCATCGTCGACTCGTTCTCCCGTATCAACG
GATACAAAAACCATTGGCGTGACATCTGGGTCGCATGGGTCATCGGAATCTTCATGGCTT
GGTTCTTGGTGAGTACCTTTAGTAGGCTAGAAATGCAATATAATCTATGATCCTTGTTCA
GTGCTACTGCGTCCTGTGCTTCCAAGAAGTCTACCATATGACTATCGAACGTACGCCGAT
TGTTCAAGAGGAGCGCGTCTCGCCGTTCTTCAGTTGGTTTAGACTTCCACGTGTTCAGGC
TCCGTCGGTGAAGGAGGAATATGTGTAAGTTATCAGGTTTTTGTTAGAGTATCTAGGGTT
TCAAATTATGGGCTCAAATAAGTTGTTGCTTAGCTTTTACTGCGGTTTTATTACCCATAA
GATTTTTGGCTTTTGACATAAAAATACAGTATCGGGTCTCGAAACGATCAAGACCTCGCC
GATACAGTATCTAGAAGGATTTCGAAATTTCTTTGAATTTTCTACAAAGTCATAGATTTT
GCAATAAAAAAGGGAATCAGACAAAAAATGTTAATTGTATTTTTCTGTCCAAGGTCGCAA
TATTCCGCAACATGGTAATAAGTAGGCAGGTATAGTGCGCAGGCGCAACTTCAGAACCTG
TCTGAACCCCGCCTGCCTATCACCTCTATTCTACGTTGTGGCGCGAATTTACGAGTTTCT
AATATTCTTGTAGCTTTAAAATTTGAACTGCAGCGCCAATTTTTGGCGTTCTAGAATGGT
CTAGTTCAAATACTTATACTTTTCCATATTTCCAAAAGTTAGGAAACATCCAATAAAATA
TGTCCAATCACCTAATTTTAGCGTCTACGAGGAAGACGTGGAGCGGCCGAACGGCACACT
GCGAAACCGTCATAACCAAGGAAATCGTCAATACGAGGTGACGACAACAACGGAATCCTT
CCATAGAACCATCAGTCCACAACAGCAGCAACAACAGCAGCAGGGACATCAAAATGATGG
ATATCGGTACTAGGTGCATACACTATCAAAATCTCATATCTCTAATTTTCTCCAATCCCA
GAAACCCAGTTTTTTTCTTAATTCTGTTATGCTCATCAAAAAGAATTTCTCATCTCTTTC
TCTCCCGCTCTCACTTAATTATTTTTTAAATTAATATTTAATCTAACTATGATATTTAAA
TAAATTTCTCTTGTATGTGTATATACCGTGCTCTTAGCGGAATGCGGCATTTTCTCTATG
TCTCTGAATACCCGGCAGTCTTTCGCTTTTTTTGCTTTTACAATTTTTTCGTTTATTTCT
TTTTTTTTGCTTTGTTTTGCACCACTCAAACCTTCAACAATAAATTATTCAAATTTCGTA
TGTTTTTGTGCCCGTCTTGACAACAGTCTCCATGGAGCTCGTCTGAAGATGGTCGAGATG
TGTTTTCGTTATATTAGTCATAAGTCGTATGCAGCTGGAGTACGTTGTCTCGCATATTGG
CGGAGTGCCAAATTCCGATAAACAGTATCTTTTGGAGAAACAGTGGGTTTCTGAAAAGTG
AGTTTTGAAGAATTCCAGTAGAATTTTGAAAACTATCAACTGAGAACAGATAAGATTAGT
TGCAGTTATCAACATTTTTTAAAGTATGTTAAAACTTTGCCGTCACTTTTATAAGTAAAA
TTTTGTCTGAAAATGTATGGAGGGTTATTTAGGATATCTTGGTCATGTTGGACTATCTGA
AATTTGTGAATTCGTACAAGTTTTGGCAATAAGCAGGACTAGTAGTAGGCAGGCAAAATT
AAAAAATATATCAAGTTTCATTCAAAAATTTGAATTTCCGCGTAAAGGCAACTTCTTATG
AAATTTTAATTCAGCCACATTCATTCATTTTCGATCATTTTTGTGGCAAAAATCTAAGTG
TTAGCGGATCTTTTTGATTTTTCTTGTATTACAGTTTCAAAACCGGAGCTACTTTTTTTT
CAAGGTCCTATTTTTCCAACAAAAAAAATTTGCTCCCAAAAACAAAATTTCAAAACACTT
CAGAGTTCAAGAATAACCAAACATCTCAACACAAAACATACTAGAATATTCATTTTTCTG
ATTTTCAGATCCCTTACCTTCCCAGTGGAAATTGAGCTTCATCTCCGTCAAAAGAGTGAA
ATTGAGAAGATAGAAATTGTTGCCCATAACAAGTTCATACCGAAAAAAATCTCGATATAC
TCTGGCCGAGACGAGGAAGGATATATTGGGTTTGTCAATTATTAAAGTTAGTAATCTTAG
CTTCCACATTTCCAGGGATGTTCAGTTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 1617..1759, 3013..3387, 3444..3506, 3556..3640, 3851..4027, 4081..4223, 4761..5209
1040..1072, 1617..1759, 3013..3387, 3444..3506, 3556..3640, 3851..4027, 4081..4223, 4761..4929
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved