Caenorhabditis_elegans Locus mix-1
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans mix-1
Caenorhabditis_elegans
mix-1
II
M106.6
17022..17096
19129
GACCTACATGGGCGGTAGAGCAAGTTGCACAAGTTGATGGACATTTTCAGTGCTTAAAT
TGTTTAAATCAATGTTCAAATTGGCGATTTCGGAGGGGGAAACATAGAATTGCTTCTGTT
TTGATGTAATATTGACTCCACCATCATTTGTCAGAATAATATGCATTGCATTATCGATTA
TCTGACCATTCCCATCATATTCTTCCTCCGGCCCATTTCCATCACCTTCAAATTGATTTT
CAATCATTTCGTGATGAACCATGTGATGATGTGAACCATCTTCTATGACAACTTCTTCAT
TGTGCTCTTGCTCGTTTTGTTTCGCCTGTCGTTGTTGACTAATCGCCACCACAATGTTCA
GCTGCTCTTCGGTGAGATGATTAAGCTCAAAGCCTGCTTCTACATCGAAACCCGCTTCGT
ACATGTCTTCCTGCGTGATTTGAACCATATTCTGAAATATAAATATTCTTTCAATTCATC
GAAAAGCTTGAAATACCATAAACTGTTGATCACCATCCTCCACAATCATATCTCCTTGTT
CAAGATCTTCCGGCTGCTGCTGCTGCTGCTCAACAATTTCTTCTTCATGCTTAGCACTTT
CAACTCGAAGTGGGGCCTGATCCTCGTGGAAAATATGATCTTCATCGGCAGGATATACAC
CTTCTGGGGAGGATCTGGAAATTCCATTTATTAATTTGAAAGAAAATGTGATTTTTATTC
TTACCCAGGAATTTCTTCTTCACGGCCTGTTGTTGGGCTAGCAGGATTTTCTTTTTCGGA
ATCCATATCTGCAACGATTTTCGTTGTTTAATAAAAATTAAAAAATAAAAATTAATAAAT
GACTCTAAATTATAGCGAAGGAGAAAAAACAAAGGAGAAAAAAATTACAAAAATCACAAG
GCAACTTTTGCGCGTCAAATCTCATACATTCCAGTCCGCAAACACTCTCACGCCACTCTG
CACACTTCTCAAAAGACGCGCCAAAAAACATTCAAAGCTCATTCGGCTTTCGAAATAAAC
ATTTTCTCAAACTCGTTATCGACTTATAACTTATTTTTGTTCAAAATCAATTCGACAGGG
TGCGCTCATAATGCACATTAAATCCATCCATCTGGATGGCTTTAAATCGTACCAAAAGCA
CACCGATATTCTCGATTTTTCGCCGACTTTCAACGCAATCACCGGTGAGTATAGTTTTGT
GCTGAAAACTAATAGTTTGAAAAACTTTAATTTCAGCATAAAATATAGTATAATAATTGT
TTTATTTCAGGATACAATGGTAGTGGAAAATCCAATATTCTCGATTCGATCTGCTTCATT
ATGGGAATCAATAAGCTCGATAATATCAGAGCAAGTATGTGGCTCTTTCTCATCACAAAA
TTATTTTGTTGTCATAGTGATACTTACGCGCTTTCGGACTGAAAAAGCACAAGATCAGAG
TAGCATAATATTTCTAGCAAAGATTTTTTAAATTGAAATTTAGAAAAAAAAATTAAGTCA
AATATCATTCCAGAATCAATGCACGAGCTGATTTCCCATGGTGGAACAAAAGCGATCGTC
CAAGTTCGCTTCGACAACACTGATAAAAGATGCTCCCCGTTCGGAATGGAACATCTCGAC
GAGATCGTCGTTCAGAGAATCATCACAGCTCAAGCAACTGGAAAAGGATGTGCAACGAGT
TACACACTGAATGGGCATGCGGCCACAAATGGAAAAATGCAAGATTTCTTCCGTGGCGTC
GGTTTGAACGTGAATAATCCACATTTTCTCATCATGCAAGGTCGTATTACTACGGTGCTA
AACATGAAGCCGGAGGAAATCCTCGGAATGGTTGAGGAAGCAGCTGGAACAAAGATGTAT
GATCAGAAGAAGAAAGACGCGGAGAAAACAATGTTTTTAAAAGATGCAAAACTCAAAGAA
GTTGATAGAATCTTCCAATCAAGTATTGATCCGAGAATGGTAAAGTTCCGTGAAGACAGA
AAGAATATGGTGGAAGTGACTCGTCTCAAGAAACTCAAAGAGAACTTTTCCCGAAAATAC
GAGGCGTTTCAATACTTTCAAACATGTGAAGCGGTGAAAAAAAGTGCAAAAGAGATTGAA
GATGCCAAAAAGGGAATTGAAGATCTCGGTGAAAAGTTTAATCAGCTTGATCTTGACTTG
AAGAATAAGGAAGATGAGAAGAAAAAGATGGAAGAATCTCGAGATGATCAACATGAAGAG
GCTGCACTTTCAGCGGCTCATCTTTCGAAACAATCTATAATGCTTCAGAAGGAGACTGTC
AAAAATCAATTGGTTGAAACAATCAATAAACTCAAAAAGGAAGGTGAACAAATCAACAAA
AGCTTGTCAAAAGATCGTGAAGTTCTCGACGCAAAACGAAAAGAACACGAAGATTCAAAG
GCGGCTAACTCGAAAGATATTCAAAGTCAATCTGATGATGAAGCTGTAAGTTCGAGAAAT
TATTCTAAAAATAAAGTTAAAAAAAAACAATTTCAGCTCGTCACAAAATACCGTAATGAC
CTCGAATCCCTAACGAGAGGAACAATTGCTAATGACAAAGGAGAACATGTGTCGATTGAG
AGTGAAATACAGTCTTGCAAGTCGACTGCGTCTCAAATGTCATCTGGGATTACTGCTGCG
AAGAAACGGTAACTTTCCTGAGAATTGGAACAAAAAATCTAATTTTGTTTATGTCGATAA
GAATAATGACAAAAATTTTGAGATATTTTAAGAAAAATCGAAAAACAAAAAGTTTCGTTT
TTTCGCTTTTTGAAAACGTCAATGATAGTTTTTTTGCGGATACTTTCAATGAAATTATTC
TGTCGTTTTCTCTTCAGTTTTCTGTTTAAAAAATTTTAAACCAGTTTTATACTATTTTTA
CATTGAAAACTGGTTTTAAACAATTTTTAAACAGAAAAATTAACATAAAACGATAAAAAA
TTGACTACAAACGATGTAATTTCATTGAAAAATTGCAAAAATTGAAAGAAAACACAACAT
CGAAAAAATAATGCATTAATTTGGAAATTCAGTAAATTTAATGGGACAAAAGAAGAAATG
TACTTTTTTAAATAGGAATATCATTGAAAAATTGGCAATTTATTTCAGCGGTGAACGTCT
ACACAACCAAATTAAACATTTGGAAGGCGAAAAAGCTACTCTCTCAGCCAGAAGTAAATC
TGACATTGGAAGTGCCGATAATTATCAAAAAGAGGTATCAGATATTTCAATTTTTTTTTC
TCCGAAAACTTAAAAATATTCAGGTCGATGAGATCAATAAGCAACTTCAATTATTGGGTT
TCAATATAGATGCTGATACGGAGAAACGAGAACACGCTGCAAAATTGCATGAGAGCATCA
CTAAGCTCAAGGATATGGATACGAGACTTCTGAATTCATACAAGTAAGGTTTTGTGTGAA
AATTCATTTTAAAAGAGTTATACCGTTTCAAAATTTAAAAAAAAAAACCTATTTTCATAA
TAAAACCCGAATTTTGTCAATTTTTCAGTATCGCAGCGAGCGGAACTTGGTTTTTATTCA
ATTATCGCCTTTTTATTGCATATTTAAATATGAAAAAAAAAAAACATATATTTTTGTAGT
ATATTATGCGTTTTTTTTTCGTGAATTCAGGTGCATTTTCTGCACATTTTTGGTGAAATC
GACCGAAAAGCCATCAACATTAACGAAAAAACGTGCAATAAAGAGTGATAATTTACTACG
AACCAAGTTCCGGCCGTTATGACACTGAAAAGTTGGTAAAATTCGAGATATTAGCTTTAA
AAAATAGTTTTCTTTCGGAATTTTGAGAAAACTTTTTTTAATTTTAAAACAGTTGTTTTT
CAAAAACTAATGCTTTTTTTCAGCTAAAATTTCAAATTTCGCGAATTTTTTTTCGAGAGT
TTCGGCATAATCAACTGAAAAAGCACCAAAATTTAGGAAAATTGCGTGATAAACTATCAC
AATATGCAATAAATTGTGGCTATTTAAAACCAAATTCCGGCCGTTACTACACTGAAAAGT
TGGCAAAATTCAAGATCTTAGCTGAAAAAAATAATTTTTTTTAAATTTTGAACCGGCATA
GCAAATTTTCAAAACGTCTCAATGATATTTTTGGTTTTTTTTTCAGACCAAAAAACAAAA
AAAAACGAAAATTTAATTTGCAACATTGAAGTTTATTTTTTTAAACAAATTTTTCTTTCC
AGGGATGGTCGATATGCATTGAACTACCAACGTCCTCCACTACATATCGATAAATTTGAT
GAAAAGCGGGACGTATTCGGATATGTCGCCCATCTTATCAAAATGAAACCAGGATGCGAG
CAATTCGCTGTTGCTGCAGATATTGCTCTTGGTGGTGTGGTTAGTTGTTTTTTTTTAAAT
TAATTTAAATATCAATTTTGAAGTGTCGGCTAAGTTTATCACTATGACACATTTGACAAA
AGATTTGAAAAAAATAGAAAAAAAGCCACAGGGAAAGTTTAGAGAAAAGTTTAAAAAGGA
GGGTTTTTTTGGAAATTGAAAAAAAAAATTAAATAGGAATATAAATAGCAGGAAAAAAAA
TTGCAAGAACTGTAGACAAATTACAATTCTCGTGAAGTTGGAGTAATGTATCCGGATTGT
GGTTCACGGAAAAACACATATTCGGTGTAGTGTGCCCAACGTTGCTCTTCATAGTCCCCG
CAGTTTCTGTGATTCATGAGCTCCTGCAAAAAAAATGAAATGGGGAATGTAAAAAGGAAA
TTTTCAATTTCGTCAAGTGGCCCACACACACATACATGCATACTACTACTCACCGTCTGA
TTAATGTTGCCCATATTGCTTGTGAGAATTGGATGATTTGCGGCGGCGAGCCCGTTTGCT
CCGGAACAGCATGTGGCAACGAGTTTAAAACCCTTCTCGGCCATCAAATCGCACGCCTAG
AAAAATATATTGATGCAATTTGATTGTCATCTGGACAACAAAAAGCTTACCCTCTCTAGA
CACTGATGCTTCAAGTACAATCGCGACGTGTATCGCTCGCCATCATCAGGACCGCCCGGA
TCACGACTCTCGTTCAGTGTATCTGCGAACACTTCCCGGCACAGTGTCGCTCGTCCACAC
ACTAGAATTCTGTGCAGTTTTCGGAATTTCACATCGGCTTGTCCGTCTCGTCCGAAGGCA
AATGTGCCCCGGTAGCCAAGGGTAATGTAGCCGCCTGAAATTGTTTTTGTACTCGTATTT
AGAATTAGAATTGGGATTGGGATTAATGTCAGAAAAAATATATACATATAGATGTATTAG
TCAGACAAGCATCGTGCGATCTTTAGTCAACACTATTATCACATCCGTGAGATCCGAAAG
GTCATGAAATTCGGTTTTTCGACAAGACACACGACACATGAGCTTAGAGTAGGACCCCCA
CCCAAAAACAAACAAACAAACCCGTCTCGGCACCAGACGTAATGGTGTTATACCCATTCG
CAGTGCGCGGACGAGGAGAAATTGATGAGGCGTTGGATAGAAGTGTTGAGAATCGTTCGA
GGCGATAAAAGTCTGCTTCATCTTTCAGTCGAGCAACTTCACGAAACTGCTCTGGAAGGG
ATAGTTTGTCGGTTCGTAAAAAGTGCAGCACATAGGCGAATAGTGGTCCGTCTCGATCAA
CGAATAGGGTTCCATCTGGCAGTGTGACAACGTTAGCTTGCTCATCTTCTGATAAAGAGC
CGGACGCAATATTTGCTAGTAATGTGTCGGTTTCTTTACTCAACGTGCTCCGAGTGGTTG
TATACATTGTGCCACCCACATTAAGAGTTATCACATCCTCAACTGATGTCATGTCTGTAA
AATTCATCGGATTAGTTTGAAAAATGATTCCAAGAATGAATTCATGAAATATAGATGGAT
AGAGAGAATAAGACGAAGAAATAAGGAAAGAGTTGTCGTTTCCTGTCTTCTCTCTTTCCT
CTTTTGATTCGGAGTGTCAAACACAAAGTGCGCTAATTTACTGCCACAATGAAAGGAATG
AAGGGACACGACACCAAAAATAACAGTGAAATACACACACAATAGGCACGATTAGGAAGA
ATATATATGTATATAGATGCACCAAGAAACGGAACGGCGCACATTTGAACAAAATGAAGA
AACCAAGCGAAAAAAAAACCGGATTGGAAAAATAAATGCGAAAAAAAAACCAGGAGGAGC
TGAGAACAAGACGGGAGCTATAAAGCGCGCACGCGTTCTGAATGGAGATATCTCGGCGGC
GTGAATGGCACGACGATATGCACAAAAAAAAATGTGAAAGAAGGAATACTACGGCATTTT
TTTTGCTGATGCAAAACATGACTAATGTGAAAGCTCTGGCTAGAATTTTTTTGGAGAACG
ACAAGAGGACCCTTTGTGTGTGTCGAACACGCCTCTACGAATATCTGTCGGTGGTCTGGT
CTCCCCCCGGGCGCTCAATTGGTCGTGGTCGCTTTTTTTAGAGCCAAAACACGAAATGAT
CGAGAGCTCGGAGACGGGGATGATTGATAATAGGGAGAGCTCTGTGGCGGTGGTATTGGC
TCCAAAGAATCAGAAGAGAATGGTGAAGAGGGGTGCAAAAGAGGCAGGGAGGAGGCGGAG
TTGCAATGGAAAAGTCACGTTTCGACGAAAGTTGAGTTGAGTGCCCCTTCGAAGAAGTGA
TGGACGTCCGTGTCGAACTTGAGGTCTTTTTTTTTACTTCTCCTGATGGAATAGCAAGAG
AGTTTCTAGATTCTGTATTTAAGAAAAAAAACATCACTTGTTGTTCTCATCTATTTTCCA
ATATACGATGAGAGTTGGACACGGTTGGTGGCAAGCTGAAAATAAGTGTCGATCTGCATG
AAATATAATTGGATGGGAGTCTCTCTCTCTACCGGATGCTTGATGTCACGAATTCTTAGT
TAGGTGCTCATTCTTTGATGGATGGAATATCCGATTTCAAAGTTGCGACAACTGGCTCGT
AAAGAAGAAGTAAAACTATAAAAAAGAACCTAAAAGTTGAAAAGTACTGAAAAGAAGAAT
AATCACTTAGAAAGGACGTTGAAGAATACAGCTCTACTGGCTCGGCTCGTTTCGTCTCAT
TCTCCTTCCCATACGGCTCCTCCTCCTCCTCTCGTTTTCTTTATTTTAGTTTTTCGCGTC
CTCCTCCTCGTCCTCGTCCTCGTCGCCGTCATCATCATCATCGTCGTTTTGGGGTCCCAG
GGTTTCGATGTAGAAGAGTGAGGAGTAACGAAAATGATCGAAGAATGAATGGCACAAAAA
AAGAGGCGGAGAATTAGATTTGGGTGCACAGCAGTTTGTGTGGAAGGAGCAAAGGGAAAA
CCCACGGGGCGAGAGGGATTAATTAAAGACACTAGCGGAAGACGATGGGACTCACAAAAA
AGAGAAAGAAGGAGGAAGGAGGAGGAAAACCAACGAAGGAAGGAAGAAAAATTGCTTGAT
GTGCAATTAGAAATTACTGGAAATTTTTTCTCCGAGTTTTCTAAATGCTGTTAAAGCTTG
TGAGGGTGGTTGAGTGTTTTCGAACGACGAATAACTTACTGATTATCTCGAATTGAATAG
ATATTATAGCTTGCGGATTAGTACAGCACAGGAGGAGGGGGAAATGGAATGGAATTTGAG
AATTAGAGATTAGAAATTTGATCCTCTTGTGCTGAATCAAATCACGATGTGAACTCAATG
TGAACCTCTTTTTTTTGAGGATGGGCGAGAAAGGGGGTTCAGTTTAAAATTTAATAGTTC
TGAAAAAAAACATAATTGCAAATATAATGGAAGTCACTGTTACTATTACCGGTACAGAGA
GTGTAGATAGTTAGAGAGTGCCAGACATCCGGGACCCAACGGGGCGGGGCGCGCGGAAGA
GACGATTTGTGTCGATTTACGAAATGATGACAACGAGGAAAATTTCGTAAATCGACACAA
ATCGTCTCTTCCGCGCGCCCCGCCCCATTGGGTCCCGGATGTCTGGCACTCTCTAACTAT
CTACACTCTCTGTACCGGTAATACTCCAATTTGATAAAGAATTGTCGTAAAAGCGTGTAA
GCCCCTAGCACGGTCATGTGTCGATTTACGAAGCTCGTGTACCCCTCGAGGAGAAGTGAG
AAAGAGTTCTTGCAGAGATTTTGGCTCTTTATTTTAAACTTCTGGATTTTTGATCATACT
CGCTAATTCTTTTTGTATTTAAGATTTCAATCGCTAGGCTATCTCGTATTTATTATGTTT
TTTTTTGGTAAAAATCACATATATACTGTTGCGAAAATGGGATTTTCAACAGTAACTATA
TAGGTTTTCACCGAAAACACAGCTAAAATCAATTTCAAAAAAATAGCGAAAACAGTTCAA
ATAGGCCAACAAATAAATTGCACACTTCCCCTCGAGGAGTACACAAACTGCGTAAACAAG
GCCATAATAGAGGTTTTTATTTAAAATCTTAAAAAATAACCGGAAATTATTTTAAAAAAA
AAGAAGGTTTTTACCAGATATAAACGAAAATGTTTGATTTTTTGCTCGAAAATTCATGAT
TATTTTCGGTTACCAATAAAATCGAAAAACGACATTCTCGGTTGAAATCTTTCTATCAAT
AATAATTTGCCTATAAATTTCAGCTTGGCAACGTCGTCGTCAGCACTCAAGATATTGCCC
GTATTCTCATCGACGGTAAAGCGTTTACGTCACGTAAAACGATGATTCCAGTATCTGAGA
ACGCGAGAAACGCGAGTAGCTACAATACATTGCCGGATGTAAAACTTAGGAGGGCTAAAG
AAATTGTGAGTGGAAAGATTACTTTTTTTTTTGATTAAAATGTTGGTTGAAAATTGCAAA
AATTCTGTTGAATTTGCACAAACATATTTGACGCGCAAAATATCTCGTAGCGAAAACTAC
AGTAATTCTTTAAAAGACTACTGTAGCTCTTGTAACGATTTACGGGCTAGATTCTCGAAA
TTAAAAAAATTCGAGCCCGTAAATCGACACAAGCTCTACAGTACTCATTTAAAGAATTAC
TGTAGTTTTCGCTACGAGATATTTTGTGCGTCAAATATGTTGCCCAATACGCAATATCAG
AATTTTGTGTTTCTGTAATAGTTTGTGAAAAAGTGAACGTTTCTTTTTATTTTTTTAAAC
TAAAAAACAAAAGAATCAATTTTTCGTCAAAATATCAGCAAAAAAACCAAAAAATCTCTG
TGCACCACCATATCAATTTACTATATATAAAGCGCGTGTCCTTCCGTCCGTTTGTAGTTT
GTAGTTTGATCTTTGATCTTTCAACTCTCTTTTCTGTAGTTGGAAGAGGTATTGGGTTGG
GAGATGGTGAGGGATAATGTCAAGGTACTGTAGTAGTACTGTAGGAGTACTGTAGGTATA
CGGTAGGGTTACTGTAGTTTAGGAAAAATTGAGTTTTTGTATACAGAAGAGGTATTGGGT
TGGGAGTTGCTGGGGGATAATGTCAAGGTACTGTAGTAGTACTGTAGGAGTACTTTAGGT
ATACGGTAGGGTTACTGTAGTTTAGGAAAAATTGAGTTTTTGTATACAGAAGAGGTATTG
GGTTGGGAGTTGCTGGGGGATAATGTCAAGGTACTGTAGTAGTACTGTAGGAGTACTGTA
GGTATACGGTAGGGTTACTGTAGTTTAGGAAAATTGAGTTTTTGTCTACAGAAGAGGTAT
TGGGTAGAGAGTTGCTGGGGGATAATGTCAAGGTACTGTAGTAGTACTGTAGGAGTACTG
TAGGTATACGGTAGGGTTTCTGTAGTTTAGGAAAATTGAGTTTTTGTCTACAGAAGAGGT
ATTGGGTAGAGAGTTGCTGGGGGATAATGCCAAGGTACTGTAGTAGTACTGTAGTAGTAT
TGTAGGTATACGGTAGGGTTACTGTAGTTTACGAAAAATTGAGTTTTTGTCTACAGAAGA
GGTATTGGGTAGAGAGTTGCTGGGGGATAATGTCAAGGTACTGTAGTAGTACTGTAGGTA
TACGGTAGGGTTTCTGTAGTTTAGGAAACATTGAGGTTTTGTCTACAGAAGAAGTATTGG
GTTGGGAGTTGGTGAGGGATAATGTCAAAGTACTGTAGTGGTACTGTAGGAGTACTGTAG
GTATACGGTAGGGTTACTGTAGTTTAGGAACAATTGAGTTTTTCTCTACAGAAGATGTAT
TGGGTTGGGAGTTGGTGAGGGATAATGTCAAGGTACTGTAGTGGTACTGTAGGAGTACTG
TAGGTATACGGTAGGGTTACTGTAGTTTAGGAAATTTTGAGTTTAAAACATTTTGAAGAG
GTGTTGGCTCGAAGAGGTGTAGTTTTTCTCTACAGAAGATGTATTGGGTTGGGAGTTGGT
GAGGGATAATGTCAAGGTACTGTAGTGGTACTGTAGGAGTACTGTAGGTATACGGTAGGG
TTACTGTAGTTTAGGAAATTTTGAGTTTAAAACATTTTGAAGAGGTGTTGGTCGGGAGTT
GGTAGGGAATAGTGTCAAGGTACTGTAGTGGTACTGTTGGGGTGCTGTAGGATTATTGTA
GGATTATTGGAGTTTGGTGGAAAATTGCGTTTTAAGTTTTTGAAAATGTATTGGCTTGGG
AATTGGTGAGGATAATGTCAAGATATTTTGATAGTTTCTTGCTTAGAGTCGGGAACATTT
GGGAAGATGTGAAAGTTTCATTATTTTTTCATAAGCCATTTTTGAATGATTGTGTCAAAC
ATTTCAAATGTTGCCAGTCGTTGGCCGCGCCATAGGCGCGGTCAGCGGCTGGTAAGATTA
TATGCAACGTACATATATGTGTGTATATAAATAAACGTATGTTTTTATGAGACCTCAAGC
TCAAAAGCTCTATTTATTCGGTGAGGTTGGTGTTTGAGGAAGAATTGGGAGAAAAACAGA
TTTTTGATTAGATTTATTTAAATTCTTTTGAAAACAGAAGTTCTTTGAAAAGATGAATTC
AATTTTGAAACAAATTCTAAGAATCGCAATTATTTTTTATGGGCTTCTAGGCTTTTCAGA
ACAAAAAATCTCACTAGAATCAATTTTATAAAATTAATATCATCAAAAAATGAATATTGA
AACATAGGATTAAACATAGGACATAGGAAAAGTTGGATTGTCACAGTGAACAGGGAATTG
GTAAATTTAAGTTTCTGCGTCATTTTTCTTGGTTGTGACGTATGCAGTCAAGCCCCTAGT
GCTCCACCTCCACATAACAAAATAGAACGAAGCTTTGGGGGAGGGGGGACCCCCAAAAAA
CACTATTTTTCTCCTCTTTTTCTCTGTCTTCTACTTAGCGCGAGGACTGAATTCATTAAG
CGAATAGGTGATGCAGAGCTAACTATATCCGGAGATGAAAATATTTGTTTTGGGGATGGA
GTTGTGGTTCCTGAAGTATTGGAACTTCCCAGAGTTATCTGAGGAATGAATTCTATAGAG
CATTGGACTAATCTAGACAACGTTCACCGAGCCGTTCCATGAATTTCCATACGATTTTGA
GAACGAGATGAAAATGAAGCAGAGCTAGTAAATATGGAGAGAAAGGAATAAGGACGTTTT
TTTCGGTAGTATTAGATTAAAATCCGTGGATCCAAGACACACAACGAGACGAACACAAAA
CGAGAATACGCTGAAAGAGAGAAATTGGTGGAAAAACAACAACGTAGCGAATAGAAGAAG
AAGAACGACGTAAAATAGAAGACGATGTGAATGCTGCTGTAAATACACAAACACATACAC
AAATTCACGGAAAATGAGACAAAGATAAGAAGAAAGGAAACGACAAAAAAAAACTTAGTT
AGCCACGACGACGTTTTGAGTGAGGAAGATGGAAGATGGAAGAGCCATTTTTCGGGTTGA
ACATACGACTGGAAATAGCACATCTATATTGGAGATGAGCTCTTCTCACGCGTTGTTTTT
GGGTAGAGAAGAGCTATTACTTGTTCGTAGTCGTTGTCGCCGAGTACAATATAATATAAT
AATAAATGGAGCATTTTTTAATGAGAAAATGGAACAATAGAGTAGTCGTTGGTTTCTGAG
AATAACTTCATACTTTTTTATATGAAGCTTCTGGGACGGGGGAGAATTTTTGAAAAAATG
TAAGGTTTAGAGAACCTTTTGTAGTTGGAAAGCGCTTCTGCCGGCTTTTACTTAAACTTT
AATAGAATAAAGTTGGATCGAAGACAAAAAGAAAAGAAAAAAAGCAACACTAGAAAGTGA
GCTTCACGTCGCCTCAGGAAGTCAATCAATCATCGGTTGCCGTCTTGTTTCCGTCGTGTT
TTTCTGTCCATTTTAGCCGCTCTCCCTCTTCAACTGAGTTTTTTTTTGCAATTTTCATGC
AAAATTCACATTTGAAATCACCTTGTGTCGAACAGAAAAGGGCAATTTTCTAACTAATAA
AACTGGGACATCGTTATCCAGAATTGCTTCTTACGGATATTGTCATATATTGTCTGGTTG
GGTGATGGAGAAAAGAATAATTGTCGGACGCCATTAAGTCCCTGGAGTCGGGTGGATACG
TGCATGGATGATGGAAGAAAAAAAAGAAGAGCACAGCAAAAAAAGAAGAAACACCATTCT
TCTCGAAGTGATGCAAACATTTGAAAAGTTGAAAACTGAGGAGCACCAGTGTGAACTAGA
AGGAAAGTGGACGATGATGTATGCTGCTCGTGTGCGTGTGCGAATATAAATTTAAGGAAA
AATGCCATTTGCATATGTTGTGCTCTTTTGTCTGCCATCTTCTGCCTCCTTGCTCTTTTT
TCCTGGAAAAACGGTCTCTGACACGTCTTCTTCTTCTTCTGTTGAGGGCATCTCCAATAA
GTTGAAAAGGAAAAAAAAGTTTCCTCTGGAGGAATGTGCTAGCAAACGGCAAAAGCAACG
TGAAGCTAATCGTCACTGTTAATTGTGAATGACTTTTTTATCCGGAAGTTGTTCGGGACT
CTTTTCTGCACGACGCGAGACTTAATGTATTGATGGATGACACGTAGCACGGGGGCAGGA
GGAACCAAGTAGACGTTCGGCAACAGGGATGTTCAAAGTAGAAATGTGCGGAAAGCGAAC
AAAACTGCTTGTTTCAATATGATATTCCAAGTTTATGAATCAAAAATTGATATAACAACA
TAGAAAATGGGTTTGCTCAATCTGAAAAAATATATATTCATTTTAGTTGCAAAATTAGAA
AAAGACCTCAAATTCTGCCCGAGTGTTGCCATTTGAAGTTTTTTTTTCGAATTTTGCAAC
AGAGATTAATATTATTTTCAGATGGAGGGAACCCATTTTCTACATTTTTATACCAATTTT
TGATTCGAAAAGTTGGATAATCATATTCAAACAAGCAATCTCCGAGTATTAGGAATGTAT
CAGGGGTGGATTCGGCAAATTGCCGATTTGCCGGACATCAATTTGCCGGAAGTTTTTCAA
GGATTTTTTTATAACACAAAAAAAAGTAGATGTATGAACATTCATAGGATGCGTACAATT
TTGCCGATTAAAACTTAAATTCCTAAAGTTCCAACAAAAAAAGTGCAAAACTAAAATTTC
GGCAATTACGGTTTTCCGGCAAATCGACAATTTGCCAAAAAAAAAAAACGTTTACCCCTG
GAATGTATATATTTCTGGAAGAAAGTTACCATTCTAATTTTTCGCAGAAATTTGAATTTT
TGGTATAGAAAAAACAAAAAAAATTATATAAAGAAAAATTAAAATCTCTGGATGTGTACA
AATAATTTTTTTTCAGGCAGAAAAATACAACGATACAGTCACCAAAATGATTGATTTGAT
TGAGTATCCCGATTTCATTAGCAATACAATTCTGAACGCTGTTGGGCAGGTATGTATTGG
TTTTTTATTTTTTTTAGTGCTCAATTTAACGATGAGACTTCCCAAAATTTCGAACAAAAA
ATATTTAATAAGATTTTCGTTTTTAGATTCTCGTCGTCGACTCATTGGACGTTGCCAGAG
AAATCGCCTACGACGAAGTTGCCAAAACTCGAATGATTACTCGGCGTGGAGATGATGTGA
GAACGAATGGAATTATGACTGGAGGATACAATGATCCAGGAAATAAACCGGCACTGATTG
CACTCGAACCAATGTATGCACGAAGACCACAGATTGAAGCTCAACAGAGAGAGCTGGACG
CTTTGAATCGGGAGCTGCAGCTTACCGAAGCATCATCGCAGAAATGTCGTGATTTGAACA
ATCAACTAGCGACAGCAATGAGAAAATTGGCTCAAGTGAAGACAAATATCAATAATTCAG
AGTTTGGAATTGTGGTTCGTGATTTGAAGGTGCACAGTGAGGAATATGAGAAGAATCAGG
CAGAAATTGAGGCAACGGTTAAGACTTTGAAAGATGTTGAAGACAAGATTAAAACACTTG
AATCTATGAAGAATAAAGACAAGAATTCGCAAGAAAAACGGAAGAAGGAATTGACCGCAT
TGCTACAGAAAGCTGAGCAGACTGTAGCACAGAATAAGAATCGAGGAGAGAAGGCAAGAC
GAGAAGTCATGTTGCTACAGTGAGTATGAGCTTATGGGCTTGATTTTAAAAAAAACGAAA
AAAAAAAGTTTCGGCACTTTTTTTACCGTAGTAAATTTTTTTCGGTGAAGAAATTTTTTT
TTATTTCTCTTCCAAACAAGGGTGTCGGTCAGGGCTGTTGCAAAAAAAATTTCCGATTTT
TTAAAATTCATACCAACTAAAACAAAAAATTTTTTTTGGTTCGAAAAAAACCAAAAAAAA
AAACTGATGTAAAAATTTTCGATTTTTAAAAGCAAATTTGGTTTGTTTTTAAAAAAAAAT
ATCAAAATTTCTTATGAAACGGAAAAAAATCGAATTTTTAAGCTTTTTACGAAAAATTGA
CATTTTTTCGCAAAAAATTCAAAAAATTTTCGGTTTTCCAGTAATTTTTAAAAATCGAAA
AACCGAAAAAAACAACATAAAAATCGTATTTTCGCTTCAAAATCAGAAAAACCCCCATCT
TTGTCAAAAAAAAACCCAAAAAATGTAGATTTTGTGAATAACAGCAATAAAATACGATTT
CAGAGCCACTGTGGAAGAAATGGAAAAGACAATAAAAAAAGACGAAGGCATATGGGAGCA
GAAGAAGAAAGAATGTGATGAGTTGGAAGAAAAGCTGCCAAATGCAATAGCAGCGCTCAA
GGATGCTGAACTCGAACAAAAAGCGGCTCAGGCAAAGCTGAACGATTTGAAGAATAATCA
ACGTCAAATTAGCACTCGACTCGGAAAAATCGCCAAAGAATGTGATGCATTGATAAGGGA
GAAGGCGAAAACTGTAAGTTTCGACGCATTGGAATTTGGAAAATGGAGGAATTCGTTTTA
ATATACTCGGAATTTTTCAATATACGAGAGAAAAATGCAAAAGAAATCACTGAAGATCGA
AAATTTCAAATTTCAAAAATTTGAAGTTTTAAATTCTCTCCAAAATGAGAACTGTGAGTC
AGTCTGCGCACCAATGAGCGATTCGTTCCGCCCACTTTTCAACCAATCAGGCGAAGTGGG
CGGGTCAGCGGTGTTCGGCAAATTTGCCGTGGTCGTCATCAATGGTGTCGGTTTTTCGAT
TTTTTGAAAATTGAAAAACCGAAAATTTTCGTTTTTCGATTTTCACCGAAAAACATCGAA
AAAATCGAAAAATGACACCCTTGGTCGTCATACTCAGTAAATCGCAATATTTTTGGAGCT
CAAAAAGTACCAAAAATAATGGAAAAAACTTCACTGGTTTTCGTTCGATTGGCAAAATTT
TTATAAAAAATTTGAATGTGTGCGGCTAATTTGAAAATTTGCCGAGCTCGGTAAATTCGG
CAAGCCCACATTTTTGAAATTTTTTCGTTCCCGGCAAATTCTGATAATTTGCCGCATGTA
GACTGAGTTCGAAGACGGTGATTAAAAAAAATTAAAGGATTAAAGGAAGATCCGTTCTTC
AAGTGCTATGCACTGCGGATCTGGGATTCAGGTACACTGCCTGGTGGTGATCCCTCTGGG
CTGTAATTTAAGCCACGTCCTAGCCGGGGACTGTGGCCGATAATCCAGTCGTGGATTGCT
CCACTTCCCAATGGAGGCTGGGTGAACCTAGGGGGTGAGGCCGGACTTGAACTCGTGACC
TCCAGACTGCTAGCGACCACCACTACCGACTGAGCTATCTGCCCCCATCATTAGAGGAAA
TTGAAATTTTTTGAAAGTTGAAATCGTGGATCTTTCTTGATTTTTTATTTTTTCAGTATA
TTGGATTATTTCAAGTATTTTTCAAACTAAATCCCCACTTCACATATATAATTTCCAATT
CTCTGCATAAATGATAATTCTATTTCAGAAAAGCAAGCGAGAAGAAAAAGAAAAAGAATT
GACTTCTCTTCAACAGTCTGAAGCTTCAAATCGGAAAGAAGCTCGTTCAAAGTTGAAAAA
GTTTGAATGGTTATCCGATGAGGAGGCTCATTTCAATAAAAAGGGTGGTCTATATGATTT
TGAAGGATACACAGTCAGCAAAGGAAAAGATGAGATTAAGGAACTCACTGATAAAATTGA
GACACTTGAACGATCGTGCTGCATTCAAAATGTGTCGAATTTAGATACATGTGAAGCTAA
GGTGAGAATCAGGAGAAAGAGCGTCGTCGAAAACTAGAAAACTCAAAAAACTGAAATAAA
TGGGCAAAAAAAATTTATGGAAAAATACATTTATTTAAAAAAAAAATTGGAATTATTACA
GAAAGCTGAGCTGAAAAACGATTGAAAAATAGGATGTTGCTTTTTATTACAAAGAAACAT
TCGTTTAAAATACTGAAATTTTTAATTTTTTTTGAAAAAGACATATTTTTTGATTTTTTT
CTTAAATCTTCAATATTTCTAGGTCCTGGACATCAAAAACAAACGAGAACGCATCACGGA
GGACTTCAACATGTTGAAAAAAACGATTGCCACCCTCGACAAGAAGAAAGTGGACGAGTT
GATTAGGGCACACGAGTCGGTGAACAAGGTGCGTCGCGCGTGGTCTAGTGGTTAGCATGT
GTGCGCTGTGTGCAATCGCTCGCGGGTTCGAGGCCGGCAGCATGTCAATGATGTCTAAAA
AATTACTACGATTTAATTCGAATTGCTGTGAGATCAATCTTATACAATTCTGAGACACTT
TTGCCGATCTTGAGCCCTTTTTTTCAATTTTTTTTGAGATAATAAATAAAATGAAAGAAT
GTATATTTTCAGGACTTTGGACAAATCTTCAACTGCCTGCTTCCCGATGCCCATGCCTCA
CTGGTACCTCCAGAGGGAAAGACAGTTTGTGAGGGTCTTGAAGTGAAAGTCTCATTCGGT
GGAGTCGTCAAGGATAGTTTACATGAACTTTCTGGAGGACAGCGGTCTCTTGTCGCGTTG
TCACTGATTTTAGCTATGCTGAAATTCAAGCCAGCTCCATTGTATATTCTCGACGAAGTT
GATGCGGCCCTTGATTTGTCACACACCGCGAATATTGGAATGATGATCAAGACGCATTTC
CATCATAATCAGGTTAGTTTTTAAAGATTTCGCTTTAAAAAAAACCGAAAAATAGTCTCA
AATTCAGGAAAAAAGATATTTTCAATCTTGCTATTTCCTTCGTTTTCCGTTGTGCTTTTT
TCTGAATCTTAGTCTATTTTCGGATTCTTTAATGCAAAAAAAGTACTTCTCAAAATTAAA
ATAATTTTTTGCAGTTCATCATCGTCTCACTCAAACAAGGAATGTTCTCAAATGCAGATG
TTCTCTTCCAAACACGTTTTGCCGATGGACATTCTACATGTACACGTCTCAATGGAGGAG
ATATTGCAGTACTTTGCCAGGATAAAGTTCTACAGGCACAAGCTCTTGAGCTCACAGATG
CTGGAAAAGCAAAGAAGGACGCCGCCGCCAAGAAGGGAGCTCAGAAGAATGACAAAGAAC
CTCCAAAGAAGAAGCCTATTGTCGTCGACGACGATGACTTCGAGTAGATTGAATAATTCA
GATCTCAATGTAAATTCTCCCCCCTCTCTGATCTTACTTTATTTTTCAATCTCGATGTTT
CATTTATTTATTTCAATATATTTACTATTTTCCCATTTTTTCCATTTGTTTCATCTCATA
AAGGTGAGTGTATTTTACTTGTGTTTTTTTTTGGAAAATTTATCAGAATGAATCATGTGA
CAAGATTAAAGCGGAATCTCATGGTGGCAAGGGTCAATAACAAAGTTGATTTAATGCTTA
AACAATAGAATAAGTTAAGTAGGAAAAAAGCGAAATGCGTGTGGTGAAGGGCAAAATATG
CGATCGATGTGAGATTTTTTGGAATGACAAATGTAGTAATATAAATTGAATAAATTTAGT
GAATTCAAACAAAATTGGTAGTCGTCGTGGTGGTCGTTGTCGTTGTGGTAGTGGTTGTGG
TGCTCGTAGCATGTGCTCCTGTGATCTTCGACGTACGATCACCCTCAATGACGACTTGTA
CAAGACCCTTGATCTGCCCATTTGGAGCCGCACGGAACAGGAGCATCACGATTTTTGTGC
ACGCAAATGTCAGAATTGCACATGTTGCCTGGAAAAAATTAAGTTTTTTATGATGAATAC
ACGCTCCGCCCCCGAAGCGAGGGTCTCGTTAGGTAATTGGCGGTAATGCAGTGAATTCGA
ATTTTTTTGATTAGTTTTGACAATTTTCAAGCATTTTTCGTCTGTTTTGCTAGGTTTTCA
GTAGTTTTTAATGATTTTATAGTCGAAATTTATGAAAAAAAAATCAGATTTTTTAAACAT
AATTTAGACAAAAAAAATCACGGAAAATGCTTGAAAATCGAGGAAACTAACAGAAAAGTT
TGAATATACAGTTTTACCGCCAAATACCTAATAGCTTTATTTTTCGTTTTTTTTTTGGAA
AAAAGGTAAGCGAAAAAAGAAAAAATTCCGATCCACTGGAAAACTCATAAATCTTCAGAA
TTTTTTTTTCCAAAAATTACAAAAGGGTTAATTTTTAATCAAGATTTTGAAGTTTTTCAA
AATAAAATTTTAAATTTACAATTTTTTTTGTCGTTTTTTGGGTTCTTAAAAAAAGTATTT
ATTTGTCCCTAAAACTACGGTAATTTATGATTACCGTGAGAATCGCGTAGACAATAATGA
GCCGGAAACTGAAACGAAGCGAATCAACAAATCCGATGAGTACAATCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1183, 1270..1353, 1513..2444, 2496..2647, 3108..3213, 3263..3402, 4202..4358, 8603..8764, 13696..13788, 13886..14478, 15003..15252, 16288..16560, 16822..16947, 17172..17471, 17654..18129
1090..1183, 1270..1353, 1513..2444, 2496..2647, 3108..3213, 3263..3402, 4202..4358, 8603..8764, 13696..13788, 13886..14478, 15003..15252, 16288..16560, 16822..16947, 17172..17471, 17654..17923
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved