Caenorhabditis_elegans Locus rpl-26
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rpl-26
Caenorhabditis_elegans
rpl-26
II
F28C6.11
1187..1319
2798
CGGATGGTGCGCATCTGGACCATTTTCGTTCATTTCTCTGTGCTCTTTCTCGCGGGCAA
GAATTCTCTCAACATCCATAATTTTGATCGAGCAATCTGCTGAACCTGTTGCCACTAAGG
AACCATCCGAATTGAACGCTGCTGCTCTACAAGGAGCTTTGTGAACCGTCAAGTAGATGG
TCTCATACTCCGATGGCTCGGAAGAAACTGGCTGCACATCAGCGTCGTATTCGAGATCCA
AGCCCGAAGAGACGGGTTCGAATTGCATCTTTAAAATACAAAATTATTAGATAGTTTCAG
GCATTTTGTGACGTTTTTGTGACCAAATCGTAAAAAATGAAACTTACCGGCGAGGATTTT
TCTTCGGCTTTGTAATCTGGATCCTCTACAAATTGCTTTGCAATTGTGACCAGTCTGAAC
AATTTATCTGAAGGCGGCGGAGCTGGAGCAGAACATCCCAAAGTATTTGCGAGGTTGACG
GCAATTTGTTGATGACCATCGTAGAAAAGCTGCCTGAAATAAGTTTTTGAAAGTATGAAC
TTTTTTAGTTTTGCTTGTTTAGCGCGAGATAACTTACCCAATAATCAGCCGATACATGTA
TTCACGATCTTTGATATCTGGCTTCATTATTAAAGTATGTTTCCTTGAATAAATATTCGA
AAATCCTCAAAGCGCAATAAATTCCTTGCAAAATTTAAACTTATATTAAAGGCGCATGCC
GTTTCCCCTGCGGTGGGTCTCGCAGCGATCTCCCCTCAAATCGTAGTCGGCTGCCTCAAA
CTAAATTTTCCTCGACGTTTTTCTCACTGGCCTAAATTTTTTTAGGAATTTTGTCGGTAT
TTTTTATTTTCAAGCATGTAATTGTCTCTAACATTAATGAGTTTTCAACCTGCATGTGTG
CTCTCCTTGTAATTCGAGAATATTTTTTATTCTCGAATTTGAATTATACTTTCTACCACC
GTAATTTTATTATTGTTACATAATATAATATTTATTTTTTCAGGTAATAATGAAGGTCAA
TCCGTTCGTCTCCAGCGATTCCGGAAAGAGCCGCAAGGCCCACTTCAACGCTCCATCCCA
CGAGCGCAGACGCATCATGTCTGCCCCACTCACCAAGGAGCTCCGCACCAAGCACGGAAT
CCGTGCTATTCCAATCAGGTTGGTTTTTTTAAATAGAAAAACTTTACTGTTTCCATTAAG
TAGTCCCGTACGTTGAAATTTTCACGTACGGTTTGGACAATATGGAGAAATGAATGTTAC
TCTTTTTGCAATGACGCTGAAACATATTTTCGCTTTGTTAGCCATAAGTTTAAAACAATT
TTTGATTTCAGAACCGATGATGAGGTCGTCGTTATGCGCGGACGCCATAAGGGAAACACT
GGACGTGTCCTCAGATGCTACCGTAAGAAGTTCGTTATCCACATCGACAAGATCACCCGC
GAGAAGGCTAACGGATCCACTGTGCACATCGGAATCCACCCTTCGAAGGTGAGGTTTGTA
TAAACTAGTTCCGGTGCACATCGACTCATCACAACTGTCAGGTTTGTGAGTTCCATGATT
CTTAATGTTGCATTCGGACTAGGAAAAGTTTATTATATTTTGAAGTGACCGAGTTCGTTC
TTTAACCCAAATTATGTTCAGGTCGCTATCACCAAGCTGAAGCTCGATAAGGATCGTCGT
GCCCTCGTTGAGCGCAAGGCTGCCGGACGTTCCCGCGTCACTGGAATCCTCAAGGGAAAG
CACACTGACGAGACCGTCAACTAAATTGTTATTAATTACAAATAAATTGTTGATTCTTTT
CCATTTGTTTTGGCTTCGATTCATTTTCAAAGAAAATATTTTAATGCTATCTGGAAATTC
CAGTAATAAGTAAACAAGAGTAATAGTACAGAAAAAGCTATTTAAAGGGTCTTCTATCCA
TTTGAGAAAATGTATCTGATGTTTTGGCGAGTTTCCTCATTTTCCACTTTCGGTCTGCAT
TGCGCGTCAAATTTGATGCACTGTGTTTGCACAATTTCACATTCTATGAAATTATCCTTG
ATTTGAACAAGATAGTATTGCTATTTATTTTCAGAAGATGTCTGGGTTGAGCATGCGTAA
CCCAGAGCGTCGGATTGAAACAAATCCATTCGACGTAGACGCGTGGAATTTACTGCTCCG
AGAACATCAGGTAGACATTTGACAACAAATTGAATCGACGTCTATTCCGTTCATTTTTCA
GTCACGACCGATTGACCAAGAACGAGATTTTTACGAAAGTCTTGTAAAACAATTTCCTAA
CTCCGGACGGTACTGGAAAGCTTACATCGAGCACGAGGTATTACAAAATAGAAATTAGAA
AAATAAAAATGATTAAAGTTTTCAGCTTCGTTCCAAAAATTTCGAAAATGTGGAGAAGGT
AATTTATCCCGGTATTTGATAAATTTAATAGTTTTCTTTTTCAGTTATTCAGTAGATGTC
TTGTGTCTGTTCTCAACATAGATCTGTGGAAATGCTATATTCATTACGTATTCGAAACGA
AAGGACAGAGGGATCAATATCGTGAAGAAATGGCTAAAGCTTACGATTTCGCACTAGAAA
AAGTTGGAATGGATGTCCAGGCTTACTCAATCTTCACAGAATACATAGCATTTTTGAAGA
AAGTGTAAGTTTTATACAAACGTTATTTGATTATTTTATTAACTTGCAGGCCGGCAGTTG
GACAGTATGCAGAAAATCAGCGAATCACAGCAGTTCGAAAAATTTATCAGAAAGCCTTGG
CAACTCCCATGCACAATCTAGAATTGATTTGGAATGACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1157, 1331..1487, 1641..1798
1009..1157, 1331..1487, 1641..1760
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved