Caenorhabditis_elegans Locus iff-2
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans iff-2
Caenorhabditis_elegans
iff-2
II
F54C9.12
1581..1662
3963
AATAGGATAATTTAATATTTTTCAAATTTTTGGTAAATTGCCAAATTTTCCAAAAAAAA
AAACGCAATTGAAGTATAAAGCTCGTAGAAAATATGTTTTTGTCAATTTCCTAAAATATG
TCCTAAAATATCCTAAAACTAAATAAATCTAAATTTTTCAGCAGCTTCAGTAGAGACTGC
AACATCTAATGAGATCTTCGTTGGTGACTACAATGCTCATAATCAGTTCAATCCAAGTTT
TTTTAAAACTTAAGCAGGAGCTGAGGCAACAAAAACAGTTGTGTAAAAGTCATGAATATT
TAGGTTGTCGGGGGGTTCAATCCATAACTAACTTACCATGTTTTGATATACTTCCTTTCC
CCTCAAACTACACGAATGTATTTTATGATAGTTTTTGTAGTGTAATAACTTCTAATAACT
TGTCTAATAACTTGTATCTTACTTGTTTCTGCTTTTATTATTAATACATTATAATAAATT
CAAAAACAAATTTGTTCAACTTTTAAGTAGGGAAAAATTGAATAATTACCAAATTGAATA
GACACACTAGTTGTCAATAGATTAGTAGGTCTGGAACAAATTGGTAAACTGTACATATAG
TAAACCATATATAATAAATATATTTACTAACCAGCTCATGAATGTAATTTTAATTCAATG
TTTAAAATTAATAAAACTTATCTAAATTGTTTTCATGCCCGTTTTTTAGTATACTCACTT
ACTACAACTCTTATCTTATCTACTACAATAACCTACAACTTAACTCTTATTTGTCTCCAT
TTTCCCGCTCCTCTGTCTCGATATGTTCCGTTTTCTCCAAAACTGCAAAATTGTATGTTT
GTCAGTGTCTCCACCATTACACCACCGTCTCAACCCTGCAAGACCGGTGCATACACGCTC
CGTCGACGGCCACGCGGTTGGTTATTGCCTGCGTAGCGACCCACACACAGTGATGGGATA
CCGAGTTCAACCGTATTTACGTAAGACCTTCGCAACTGTTTAGGCAACTTTTGAAAGTCT
TTTTTTGAAAAGTTTCAGACTGTTTTCTTGTGATTTTCAAGACAAAACTGTGTAAGTATT
AGGGAATGCTTGGTTTTTGTCTTAGATATAGTATCTACCTACAATATGCTAAGTTGATAT
GATAAATTATTGATTGATGATGTTTTTTCTATTTGTCATCATTTTTAGGTTATTATGGTT
TAAATCAATTTAGATACATTCAATTTGCTGACTTTTTTGAAATGGCTGTAAAAACTAGTA
GATTTATCAAATTGGATCTAGGTCCCCATTTCTTAAGGACTATGTATTTGACGCTTTACT
ATATTTTTTCTGGTTTTTATTTATTCTTAAATATTGTTATCATTTAAAAAATTAACTTGT
GCGTTGTAGGGTACCAATATGTCTGACGATCATCACGACGACGAGCACTTCCACACCGGA
GACTCTGGAGCTGCTGCCACATTCCCAAAGCAGTGCTCTGCTCTCCGTAAGAACGAGCAT
GTCATGATCAAGGGACGCCCATGCAAGGTTCGCTTTGTTTTAAAATGTTGAAAAATTAAA
TAAACTTAGAAGATGTTTTGTGAAAAAGTGCGATGAATGACTTGGATAAGTTTCGGCTGA
AACTTGGTGATGCCAACTTTTTAAAACTGCTGAGCACTTTTTCTCAAACAAAAACCCAAT
AAATATGAAAGAACTATATATATAGTTATATAAACTATTCACTCATAGTTTTTTACAAAA
ACTGAAAGCTTACCAAATTGATAATTAATTCCAAAACAAAAAACTCCTGAAATTATTTAG
CTCACAAAATACCCAGATAAGATGATATGATTTAATCCTAAAAACTGTTAGTCTAAACAT
TAGATAGGCCAGATATTTATATTCTCAGAGGCGAGTGAAGAGGCGGATCAGAGACACCCC
GCCATGCTTTTACCGGAAGGAAATTCTAAGACAGTTAATTTGAATTTTAGTTCTAATTTA
AATATTAACATTTTAAAATTGCAAAAAATATTTGAGGAATAAAAAAAAAGTATACATACA
ATCGTAGCACCATGCTTCTAGAATGTGGACAAATCAACTTTGCGTAACCATAAAAGTTAT
CTGAAAGTTGTAGATCGTCGAAATGTCGACCTCCAAGACCGGAAAGCACGGTCACGCTAA
GGTCCACATGGTCGCCATCGACATCTTCACCAGCAAGAAGCTTGAAGATATCTGTCCATC
CACCCACAACATGGATGTTCCAGTCGTCAAGCGTCGTGAGTACTTGGTAGGTTTTCCAAA
ATTTCATATTGCTAAACTATCACTAAATTTTTATTCAATTTTCAATATGCTTGTTCTTTC
AGTTGATGGCCATCGATGACGGATATTGCTCCCTCATGGACCCAGAGTCCTGCGAGCAAA
AGGATGACCTCAAGCTTCCCGATACTGAGCTCGGACAACAGATCCGTGATGCTTATGAGA
AGGACGAGGGATCCGTTTTGGTCCAAGTTGTCTCTGCTATCGGAGAAGAGGCTATCCTCG
GATGGAAGGTCAGCACCAAGGAATAAATCGTCAAAGGAACCCCCTGCCAACTGCTCATGA
ATCCTGATTCCCCCGTTCCACCCCGCAAAACTTTCACTGTATGAATGGTGCTGCTTGACA
TTCCATTCCAGAATTCAAGTATAACCCATCATCAAGTGCTCGTGTTATTTTTCTTGTTTT
CATTAACTTTTTTTTTTGCTTTTTTTCAAAACATAACTGAGAATTTAATTTCAAATAAAT
TATCAGAAAATTTTGGTTTCCATTTTATTTAAAAACTATCAATCCACCTCCATGAATTCA
CTCGTTTTTTCTTTTGCCTTCTTGTTCCATCATCATCCGTAGGTAATTTGTTTCTGTTCC
ATCATCTCACACACTCTCTCTTATACACGCACAACAATTGACTAAATTTGATTTATAAAT
GAAGTTGCACGGAGAGTTGCTTTTCGATTCACTTTCATTTGATTCTGAATCTAGGAATAG
TTGAAGAGAAAAGAAGCGATTTCATTTCCGGTACTGGGAGATATCTGACCAGAATCTTAG
TCAGATGCTTCTTTTGTTTTTCGATTGACTAGGAAATATGTTACTAAAGAATAATTCCTA
GAGTTTTTAAGTTTTTCAGTTCTAAACGCTTTCCTATAAACGCAATCCTGGAAATGTTTA
ATGACTCGTAAAGCAACCGTTTTTGACAAGAGACACCTGTGATTTATACGTTTTTCAAGC
TTCATCAAAATAGTGCCTAGAATTTCCATTCGTTCTTTCAACTTTCAGTCTGAAAAGAAA
CATATCGATGTATCTTGTTAGGTTATTTTGGCTCACTTTTATAAAAATATCTTCACTTAC
TGGAACGGTCATATTGTTTTTTTGCGTACTTATACCTTTCTCTGCTTGACTTCAAAACTT
AATTTTAACAAAAACAAGAGGCGTGGAAAACTTTAAAAGCTTCTTGGTAACAACTCGACC
TTTCTAATGGGATTTTAAAGTCTAGACACGTGTTTACCAATTATCAGCATACTTGTTGTA
TTGTCTATTTTAGTTTATAAATTAGTTCAAGAATAAGGTTCAATGTTTTTGAAATTGACG
CTGTTTTCATTTTTGATTTGACAGCTTTCAAGGGCACGTTACCAGCTTTTCCAAACCGAG
CTGTAGAAATCTGCCAATGGTGCACTAAAAAACTTTCTACAAGTATCGTGCTGAATTTCT
TAACTTCTGTAACTGAAACCTCGTTTGTATGAACAAAAACTTAGTTAAGACCGTGTAATA
GTTCAAATTGAGTTTGCATTGTTGATTCGCATCAGAAATTTAAAACAAGCATATCAGGCA
TTGAATATAATTTGCAAATTTCAGAATCGCCGCTCAAAATATCTGAAAAAAGAATATGAC
GGATCAAAGAATAAATAAAGAGAAAATGGGCGTGGCTGAGCCGTCTCATATTCACTCATT
TCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1389..1526, 2113..2265, 2342..2963
1398..1526, 2113..2265, 2342..2542
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved