Caenorhabditis_elegans Locus T24H7.2
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T24H7.2
Caenorhabditis_elegans
T24H7.2
II
T24H7.6
2409..2547
5533
ATATAATTTTATTATTTATTTTAATAAGATTTTAACTTCATAATTAAGAACTCAGTGAT
GACACAACAATCTGACAAAGATGCCTCTGTGAGCGAGACGACGACTCCACCAACAACTCC
TGTTACTGTCAAAAAGCCGGCGCTTTGTGGGTTCGTTGACTATAATTTTTGTTTAAATTT
TATTTGAAATTTTCAGAAGTTGTGATTGTGATGTGGAGAAGTCCACCCTTGAGGAAGAAG
CAATGGCAGCTGTTCGTGAAAATGCATTTGCAGTCAACTTGATTGGTGTAAGCGAAATGC
TTCCACGTACTTCACAACTTCTCTTCATTAATGTAACTACATTCGAGAATCACACTCATT
GTATCGAGCTCACTCGTAAGTTCACTCAGATGAGCAATAAATAATTATAAACCGAATATA
TTCAGAAAAGGGATGGCGAGTTGCATCAAATCGCAATGACTGCATGAATGGTGATTTCCG
ACAACTCGATATTCATACAAAGTATTTCGAGTCACTCCATACGCTTCTTATGGATATTTC
GCCACTTTTCCGGTACCATACATTTTTATTGCAAATTTCTAAAATAATTTTTACAGTGAG
ACATTCGGATCGAAATTGATCTCCAAGTTGAGTGAACTGAAGAAGGAAAGAAGCGATTCC
GATGAATAATTTCTCACTTCAAATCTTCATGTTCTACCATTATTACAATTCGCATTATTT
TCCTAGTTACATTGCTCAAATTTGCGTTCAAACACATCTAAGTTTTTTTCTAGAATATTA
AGCGGTCTTGTTACGTGGCAACTCGCGTAATCTTGCCAACCACCGTTTTGTCTCATTACA
CACTTTTATTCCATCCCCGTATACTTTGTTCCGTTGTGAAGTTTTCTGTGTATAAAGTAT
GTCAAAATTTTCTTTTTTTTTTCAATTAAGCGTATTCAGACGTTTACTCGTTTTTCTTAC
CTGAAACAAATGCAAATTAGGTATTAATCAAGCCAAATTTCAGTGAACATGCGGTTACAT
GGGACAGTCTTGCTGGTTATACTCCTCGGTTGCCTTTTCGCAACTTCAGGTAACAAAAAA
ACGGTATTGGAAATATCATAATTATTATTTTTAAGATGGACAGTTGGCCGCCATGACAAT
TGACCTCGGGACTCAATTCCTTAAAATTGGAATTGTAAAACCTGGAATTCCAATGGACAT
TGCTCTGAATACGGAATCGAGAAGGAAGACACCGAATGTTGTTATGATTCAGGATGGCCA
CCGAACTTTCGCTGATGCAGCTATCGGAATGCAAGTCCGGTATCCTCATCTTGTTCATGG
ACAACTCAACGATTTAGTCGGCAAATCCACACAACATCCTTCATTTGAGCTATTCAAAAG
ACGAAATACCTTCTTCGAGGTTGATGATGCTCCGAAGAATGCTTCTTCTATTAACTTCAA
GCTTGGGTAGGCATCGTTTCTTTATGTTTCCTATAAAAAATAATAATGTATTTTTCAGCG
GAGAAAGCTATACAGTTGAAGCACTAACTGCTATGATTTTAGCAAACGCGAAGAAGTTTA
CTGAAGAATATGCACAAGCTGCTGAAATCAAAGATGTTGTTATCACTGTTCCGGTCTACT
TTACACCTGCTGAAAGATTGGCTGTAGAGCGTGCAGCTCAAATGGCTGGACTCACCGTCC
TTCAACTTATCAATGATGGTACAGCTGCAGCATTGAGTCATGGAATCTTCCGTAGAAAAG
AAATCGGTGAGAAACCGCAGAGATTAATGGTCTATGACATGGGAGCAGCTAAGACTACTG
CAACAATTGTCGAGTTTAAGTTGGTCAAGGAGAAGTACGAGAAACAACCAAAAATGACAG
TCCTGGGAGTAGGGTTCGATCGAACATTAGGAGGAATTGAGATGACCAATCGTCTTAGAG
ATCATCTTATTGAGATGTTCGAGAAGAATTATAAACCGAAGACAAAGGTCAATACGAACA
GAAGAGCGATGACAAAGTTTTCAAAAGAAGCTGAAAGATTGAAGCAAGTTCTATCTGCCA
ATGCCGAACATTTTGCTCAAATCGAGAGTGCTCATGAAGATATCGATGCTAAACTGAAAG
TCACTCGTGAGGATTTCAATCATCTTATTTCCGACATGGAATCTCGTTTTGGCGAGCCAA
TTGAACAGGCTCTTCGGATGGCTCAGATTCCTATCGATGATATTGATCAATTTGTGCTGA
TGGGAGCTGGAACCAGAGTGCCAAAAGTACAGGAAATTGTGCAGAAAACAATTGGAACGT
AAGTGAGCGCTGTCGCAAAGCCACCGTTGTATCTAGGGCGCTCACGCAACGCGATTTCTC
GTACCTCAATGGCGGAGTGGTTGTATGTGCTATTGTCGCTCACACAATGTAGGTTCGACC
CCCGCTTTACTGCGTCTCTCCAACCCGGACAACTCGCAACTTGTTGCAATGGTCAGTTCG
ACTGTTAGAGACGCTAAATAAGAAAATTGGCGGATTCGCTAACGTCGCGTCCCATGACCG
GAGTTTGAAAGTAGGCCGCTGAACAATTTTTTTAAATTTCAGAAAAGAGATCGGAAAGTT
CCTGAACACTGATGAAGCCGTCGCTATGGGAGCCCTATTTCAAGCAGCTCATCTCAGTAA
AGGATTCAAAGTCAAGCCGTTCAACATCGAGGAAAAAGTTATTTTCCCTGTTGAAGTTCA
TTTTGTCAGCAAAATTCGAGATGAAAAGACTGAAGAGATTACTGGAGAGAAAAATGTGGT
TAAAACCTTGTTTGCTGCCAATTCCGTCTACCCTACCCACCCAAAGACGATTTCATTAAC
CTCTTACTCGGATGATTTTTCAGTTGCATTGAAATATGGAAAAATCGAAAGTTTTACGAA
GCAACAAGTTCAAGAAATTGGAAGTTTGTTGGATAATCTCGTTGATGTTGAAATTAGTGG
TCTGAGTGAGGCATTGAAAAATCGATCCAGTGAAGAATCAGAGTTCAAGGGAGTGAAAGT
TAGCTTTATTGTGGATGCATCTGGAATTGTACGAGTTAGAAGAGCCGAAGCTTTGTTTGA
GCCAAAATCTGGATTAGTTGGATGTAAGATTTGGTTTTCTGATTTCTATTCATATTGTTT
TTGTTTCAGCAATTGCAAGCACCATCAGTGGGCTATTTTCATCAAAAACTGAAGAAGGTG
AACCGACAACTGATGACAGTACTCCACAGAGCACTGAAGAGAAAACAGAGGAAAAAGAGT
CTGTGAAAGTCGAAGATTCAACTCCTGAACCAGAACCCGAAACCCCTGTCAATTCCACAT
CTGAAGAAAGTCCAAAAACAAATGAAACTGAGAAAAATGCTTCTTCCGGTAATGCAACCG
AAGTGAAAGAAAAGAAAAAGGAACTTCCATCAATTGTTCGCTTGCGCATTACCAACAAAT
ATCCATCTGCATTCGTTCCAAATAAATATGATGTTCAAGAAGAAAAACGTAGAATGGAAG
CATTTGCTGAAAAAGAACGACTTGCATCCGAGAGAGCTGCGGTGGAAAATGAATTGGAAT
CTTTCAATTTTGAATGTTCACAATATCTCGAAGAAACTGAGTTCACTGATTACATGGCTG
ATGAGGAGAAAACAAAATTGGAAGATTCTGTGAAAAGAATTCGTGCTTGGCTCGAAGACG
ATGTGACGAAAGATACACCAACGAAGGATTTCACAGATAATTTGCTCGAATTGAAGAATG
TTGTACGGAGTGTGAAAAAGAGACAAGAACACGACAAGGCAGTTCCAGAGAAGTTGAAGA
GCTTGGAGACTCTTCTGGAAACCACTTTCTCATTGACCACTTTGGGTAACAATGTTGACG
AGGAGAAGGCACTATTCAAAAAGGTACAGAATATATCTAAATTCGTGTAGCAATATTTTT
TTCAGGAAGACCGTGACGGTTTGAAATCTAAATTGGACAAACTGAAAATTTGGGTCACAG
ATGTTCGGAAACACCTAGATTTGAAGAAGAAAACAGATGATTTCAACTTCACTGGAAAAG
ATATTGACACCAAGGTACATTGAGATGAACTACAAACACGAATACTAATTAATCATTTTA
TTTTTCAGACCAAAAATCTGAACCGTGAAGTAGATCGATTCATGAAGAAAATGAAGAAGA
TCACAACATTGGACGATCTTGCCAAAGACGGAAAAATTGATATCGACACCATTGTAGAAG
AAGCAGAGAAGAAAAAAGCCGAACAAGACAAGAAGAAGGAAAAGAAAAGCACGAAGAAAG
CAAACGAGTCGAAAGTAGAAAACGAGTCAGAGATAAAGACCGAGCTTTAAATTTTTTGAA
AATTATATTATCATTTGGAGCATTCTCTTCCAACGGGATATTTTTTACTCGTTTCTAAAT
ACTTGTTCAATCTTTTTCTCATGTTTGCCAATGCTTTGGGATTTTAATTTATTAAAAGTT
CGAATGTGATATGATGGTGATTACTCCCATGGTTGTATTTTTTTTTGTTTTCTTGTAGTC
TTCTTTGATAAAAAAAATAAAAATATTTGTCTGTAAACGCTTGTAATTCAGTTATCGGCC
GATATCGGTACTCTATGTCTACAACAAATTTTGCTGGCGAAACTACTGTTTTTGAATTAC
CGCGTACATTGTGTCTGCGCCTCTCTGCGTCTTGCATTGCCTCTTCAACGAACTAAAGGC
GCATGGTATTTCCTGAGTAGGTCTCAGAGCGTCTGTTTCCCTGCGTATTTCTCTTCTTTC
TCAAGTCGCTTTTTCTTTGTTTTTTATGCTCTGAAAATGATTTTTATCTAATGAATGTTG
GTTATATTCGAGATATTTGTATTTTCCATGTTTACTTTTTATATGGTAGCAATGCGGCAC
AAAAACGGTTTCAATGCCGCATAATTCAAATTTCGTTTTTAAAATAAGTAAGATAATGAT
ATCCAAATTGAATATTTTGATAATTCAAAGCCGAATTTCTTTTAAATTAAAAATTTACGC
ATATTGATATGCTCATTCTTATTGTTATCATGCTAATCAACTCATGAATTTAACCTTGTT
CTCTTTTGAAACGATTTTTGCATCATATTTCTTTTGAGTCATCATAATGTGTCTATTTTG
CAGCAAAATGGCGAAACAAGGGCAAGAAGCAATGAAGAAGGCTATTCAAAATGCTAGAGG
AGCTGGAGTTGGTCTAGGACTCGTGGCTGCTGCCGGAGCCGCCGTTTACGGTGTCGCCCA
GTCAATGTTCACTGGTAATTATTTATATTAAGTATAACGATCAAATTAATTGTTTTCAGT
GGAAGCTGGACACCGAGCTATCATGTTCAACAGAATTGGAGGATTGTCGACGGATTTGTA
CAAGGAAGGACTTCACTTCAGAATCCCATGGTTCCAATATCCAATCATCTATGATATCCG
TGCCAGACCAAACCAGGTACGTATACAATTTTCATAGTGGCGGTTTTGAAAATTTAAACA
CTTATTTTTAAAAGTATTCCTGCGAAAAAGTATTCATCTGATAATCAGTCATAATTCAAA
TTGTAGATTCGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1115..1445, 1498..2277, 2562..3082, 3129..3862, 3905..4033, 4088..4533
1008..1068, 1115..1445, 1498..2277, 2562..3082, 3129..3862, 3905..4033, 4088..4306
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved