Caenorhabditis_elegans Locus mdt-4
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans mdt-4
Caenorhabditis_elegans
mdt-4
II
ZK546.18
2424..2548
3817
TTGAGCGGAAAGGAAAAGGACCGGCGAAGGTAACATCAGCGATGGCTGAAAAAATGGCA
GAGGAGAAGCGTTTGAAAAGACGGGAGAGCAAGCTGAAGCTGAAACAAAGAAGAGCAGAG
GAGAAGAAAGGAAAAGAGGCAGCAGCTCAAGTGAAGAAAGAGACTGTTGAAAGCACAGAA
AATGGCAATGAGCCTGTCGAGAAGCAGAAATCTGGAATTTCATTCAATAATCTCAAGTTT
GAAATCAAAGAAGACAAGCAGAGGGGCAAGAAACAAAGAGTGAGTAAAAATATTTTTATC
TGAAATATCTGAAATTTTCAGACCGCCAAAAAAGATCGAGCTCTTAAACTTACCGGACGT
GACTATAAATCACTTATCGCTAAAGTCGAAGAGACAAAAGCAACAATTGCCAAAGTTCGC
GAAGCTGATCCACATAAGGCTACCATCATGGAAGATGAGCTAAAGTGGGAGAAAACACTG
AAAAGAGCAGCTGGTGGAAAAGTGAAAGATAATTTGGGAATGCTCAAGAAGGCTTTGGTG
AAGAAGAATAAGATGAAGGATAGAAGAAAGCAGAAATGGGAGAACCGAGAGAATAAGACG
GAGGGAGAGAAGCAAACGGTATGTTGATTGGTAGAAAATCCTTTAAGATTTGAATTTTTA
TTTTTCAGAAGCAAGACAAGAGAAAGAAGAATCTCCAGAAGCGCATCGATGACGTCAAGA
AGAGAAAGATGAACAAGTTGAGAAACAAGGGAAGAATCCTCTAAACAACACACATTTATC
CGCTTTTAATTTCTCGTTGTTGAACATTTTTTTGTTAATTTTTACTGTTAACTTTTTTCT
TTAAATCTGTGGCCTGTTGTTAAGTTTTTAAGTTTTCAAATTATACTAAATTCTTTGAAA
AATATTCTCTTTTTTTTTGAAACTTGTGCCGTTGTTTCGGTAATTAATTATTTTAAAAGT
TGTTAATGTATGTTCGATGGTTGTATTGTTCTAGATCTCAAATGGCAGAAACAGATGAAC
GAAGTCTACGGGATTTGCTCCTGGAATCTGCAGATGATTTGGAGCATATTGTTAAAATGG
TACGTTCTAAAAAAATTTGAAACAATATTATAGTTTATTTTAAAATTACTTTTTACTGTG
AGTTCATCTTATAGAATTCATGAACCCACATAATCAATTATTGTTTCAGATCGTCGATAC
ACTCATCAATCGGGACAAAAGTGTTATGCTGAAAAATGGAGAAACCGTTACGAACATTAT
CAAGCTGTTTGACTCAAAACAGGATAGCATAAAGACTTTGCTGAAGAGGGTTCCTGAGTT
TCAAGAACGAGAGCAGCTCATTCGGACGCTTGAAGCCCACGTGGAGAAACGAGACGAAGT
TATTCAACAACTTGAAACGAATTTGAAGTCATGTGAGGTGGCTCTGACGCGATCTTGTTT
TCATGTAAATTTTGTTGGAAACAAAGACTTTTTTCGAAATACGTTTATTTCAGGCAAACC
AGAAGCTCAAGCAAATGAAAGAAGCTGAATTGAGACCAGTCAATAGTGAGATGCTCATCA
AACTGGCTCATCAGATCAGTAAGCACAACTCCGTATCTGCACCACTCACTTGGCAAATGG
GAGATCCATCGCGTCCGTTTCCTCAGGAACACGAATTTCGAGCTGGTCACCTATTGAATT
CAAAAGTTCAGAGCACTGGACCTCAGCTTTTACCCGGAAAGAACGTCGCTCAGAGGCCGC
TTATTACGGTATGTTTATGGAAACTTGTTGAAATGTGAATCCTCACCTGAAATATTTGAT
AAATGCATTTATAAATGCATTTATATAAATGCAATACTTCTAATGTTTTCTACGTTAATC
TGAAATTCTTTTCACACTGTAACCGAACAGCTGTGAATCACGTGATTTATGTCTTATCTT
CTTACATTATCTAACAGTCATTCCTTCTAATGATCAAATTATGAGTGATAAGAAATATTC
AGTTCATATTGTGATCTCTTTCCTTCTACGTTATTCGTAGTAAATTTTATAAATAAAATT
AAGATTCAACGTTCAATCAATATTATTTCAGTCTCCATCCGCATCCTCATCCAACGGTGG
AACAGCTCCAATTCGAACTGTCGGCACTCCTCTTATTAATTCTGCTCCGACTGGAGATTT
CAGTCCACGAACTGGTTTTGGCACCGACGAGCCTCCACCGATTCAACAGCAAGTACTCCG
TGGAGCCACTCCAAATGAAAAGCAATGGCAGAATCCGGGAGTTTCAGGAGCCACCTCAAC
GCAATCCCCTTACAACCGTGTCTCGCAGGTCAGTGCAAACCGAGTGTACATAGACAGTGT
TACTGGCGGCCCGCAAATGATGCACGGGTGGCGCAGTGGTAACGCGTTTGCCCGTTGTTC
AGCTGTCCACCAGTTCGATTCTCAATGCACACAGAAAGTCGAGATTGCCGGCTTCAAAGG
CTTTATCGTTGATTACGTGTGCTATAACAACGCCATAGGTATCATTCTTCGTCTTCTTAG
GCGCGGAACATCTAAATATGGCTACATTTATCTGCTATTTTATAATTTTCCAATAAATAA
CATATTTTCAGAGTCCTTCTTCCTCGCCAAACGTGAAGCTGAAAATTACTGGACTTCCGA
ATCGTCCAGGAGGTATCGATCAAGTTCAAGATGTGCGGGATGTCGAACAAATGTCGTCGG
ACAGCTCCAACTCGTCAGATAGTTCAGATGATGAAGGCGCATCGAAAAAGACTGGCAGTA
GCAATAAATAATGAAAGATCTCTGTAAATTCTGGTATTTTACTTATTGTACGTTGATAAA
TAAACACAATTTTCTATATATCTTGTGTTTAACAGTGACACTAACTGATTGCATGTGGTT
CAGTGTCCACGCCATGTTTACCGCTATGCCAGCTGCCTTTCTTTCTTTCTTTATGTCCTC
TAATCTATTTACTCCTTGAACTTTTTTTTCAACAATTCTAGTAACTAATTATATTTAGAA
ATATGCCAAATTTTGGAATATACCTAAGTTAGCTTTTGATTCAAATCTTATTTTAAAAAA
ACACTCACCCCATCTAGAGACGCAGAAACGAAAGGGACCACCCATGACAAGAGAGATGCG
GAGTACGTGAAAAGATGCACAAAACATGTTGCAGTGAAAGTGTTGTTAGCCATCACTTTT
TTTTGTTTTTGTGGGCTCAAATCAGTTTGAAGAAAAGTTGAAGTTGTAAAATTTCGCCTC
CTTTCGTTTTTTATGTCATTTTATATTACTTGCCCTTTGGTAATAGATAAGAAATTATCT
CTCCCATCAGACACATTCCCACACATCTTCTTTTGACTTGCCTCCACACAACTAATCTAG
ATATAGATGGGCGGTCCTGATTCTTGAATACAATACATGTGGAATGTTTTGTTTCGGAAG
GATTCTTCAAGATTTCATTTGAATTTTCTTAATTGAATTAATACTTTCTATCTTATTATA
CTCTTAAATTTGCGATTTTTCGGCAAAAAATACTGCATCTGGTCTCGACAAAGCTTTCTT
TAATTTGTTGTTAAATACAAACGGATGTGCACCTTTAAAGAGTACTGTACTTTCAAACTT
TTGTTGCTATATAATTTTCATCGATTTTCCGATAGTTTTCGATAGAATAAAGCATAAATT
TCACCAAAATCAACACGACAGTTTGAACACACCTTTCTTATTTAGAAAAAATGAAACAAT
TGTCGTGGCGAGATCAGGCATCGTACTTTTGACGCAAAACATTGCGTCTAGATAATAATT
TCCATGTTTTCAGATATGGTAACTGAAATGAGCCATGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 1189..1443, 1493..1747, 2071..2307, 2591..2817
1001..1078, 1189..1443, 1493..1747, 2071..2307, 2591..2767
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved