Caenorhabditis_elegans Locus prpf-4
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans prpf-4
Caenorhabditis_elegans
prpf-4
I
F22D6.16
3815..3949
5218
ATTCGGAAATACCTCATCGGTTAGACGGAGTCCAACCGCAATCATTGCTGAAATAATGA
GTGTTTTAGAAAGAAAAGCATTGAAACAAATGAAAACATCAGGGACAGAGAAGAGCATTG
CTCATGATAATACATAAGGTTTCGAAATACAAAGCGCAAGTCGAGGTGTAACAATTTTTA
TAGATTTTTCGTGAAAAAGTTGAAAATATTTGGAACTTAAGAAGTATAAACATGACTTTT
CCAATCAAAACTATGTTTCAAGAAATTTTCAAGCTCCAATCGAAAACAAGTCTTGTACAG
TATACCTCAAAGGCGCTTTGCTGCAGTCAAACGAGAGTCTCGCAACGATGAATGTGTACG
GCTAAAATGTTGTTTTCAAATTATACTTCATTTCGAATCTAGTTTTAAAGATTGAATCTC
ATTTAAACTTAAAACTTAATTATTTATTTTCTAAATTTCAAATTCAGAATTTCGTTCACT
CATGAACGGACAATGCGCAAGAACCGACTACTGGCGCGTTACACTTGACGTGTTTTCCGT
CATAACTGATTTTCGAAAGAAAAAAATTATTAAGCGATGAAAACACTCATCTACTTTCAT
AATTTTGCTATTTATTTTCTGAATATTATTTAACAAGATATTTTTAAATTTTAGTTTTTT
CGAAGAAAAAGCTTCTATCAATCCATGTTTTCGGAAAGCGGCGTCAAAGCAACACAATGA
CGAAACTTTTTAACTTGGAAACTTTTAGCCTTGATCTAACTTTGAGTTTTCTTCCCTTAT
TTCTGATCTTCCTCTTTTCGCTCAATATTATTTTAAGATAAATGTCTTTTGCGCACCTTC
TTCCGCCACTCTCCAAGAAGTTTATGAGGAAACGTCATCTTGTGACCCGGTATCAGCTGA
AAATATTTTCTCGCTTGCGGCTCAGTTAGGCTGGGGGTTGAAAGTGTGCATGAGGAAAGC
GGCAGAACATGTGAATCTCAATTTGAAAATTTTCAGAAAAACGCCGGTGATCGAGTATCG
AAATGGAGGACAATCGTGTTGAAGAGGATGGGGAAGTGAAATCCGATGTTGGAACGTCTT
CAGATGAGAAGGCATCGGATTCCGAGGTTGAGAAGAGACAAAGGACTGATTCGGAAAGAT
CTGGAAAAGGTGAGAATATTAAATTGTTTCAAATAATTAGTTTTATTTACAGATAAAAAG
AAGAAGCATAAGAAAGAGAAAAAACACAAAAAGGATAAGAAGCATAAGAAGGAGAAAAAA
CATAAACGCGAAAAAGAAGTTGAAATGGAAAATGATGGTCCTCCAGCAAAAAAGAGAACT
TTAGAAGAAGTCGATACTAAAAAAGACGAATCTAAAAAGAAAGAAGCAAAAGAATCATCT
CGAAACAATGAAGATGAACTCAGAAATCCTCCTAGAAGGGAACGCTCAAAAAGTGCTGAA
CGTAGGGATCGTGAATTGCGAGAAAGACGAGATGCTGAACGAAGAGATCGATCACTTAGT
AAAGAACGAAGATTGATTCAGAGAAAAAGAGAAGATAACAGAAGAGATCCGCGTGCTCAT
GAAGGAAATCGTCGTAGAGATAGAACACCAGAAAGATTCAGAAACAACAGAGATCGTCGT
GACAGAGATGGAAGAAGAGAGGATCGTCATAGAAGAAGTCCTGATAGAAGACGTGACTCG
GATAGAAAAAGAGAGGATGGGAAGAGAAAAGATGAGTCAAAGGATGTTGAGTGGAATTTG
GATTCTGATTCTGATGATGAACAGAAGAAAATTGAAGCGGCAAGAAAGCGACGAATTCAA
ATTATAAAGAAGATTGAAGGGCATACTGAAGAAAATGTGAGTTATTCTTCAATTTCTGAA
AATTTTAGTTCTATTCACAATGTATCTCAATACCTCAATTTTGATTTTTGTTATATTTAA
AAGCTTTATCGGACACCTTAATACCTTTATATGTTCGGATTGAATGCAAGAACCATATTC
AAATCCAATCGAGCCCATTTTTGAACGTATCGATCAAAAATTAGTCTATCTTTCTAAAAG
ATAAATTGTTTACAGATATTTTATGTTTTTACAGACTCCGCGTGATAGCAGTACTCCAAG
AAGTGATACAATCGGAGACAAAAAGACTGACGAATCAGAAGACAGTAGCTCCGATTCGGA
AGATGATGAAGACGATCGCAAACTGGCTGAAGCAAAAGATCTGATAAAATCTGTAAGATA
AATAGAAAAAAATCGGTTAGACAATAATTTTGAAAATTTCAGACCCGATTCGGAAGCGAG
CAAGGGAGTGGAGCATCGACTCCAGTAAGTATTCAATCGGATAATGACACTCCAACTGAT
TTCTTCTCTGGTCTTCGAGATAAAATGGTTCACATGAAAGATGCAGATGAACATAATGTA
GACGAAGTACTTCAAAGAGGAAAAGATGAAGAATACAGAGAAGACTGGCATACTCAATTG
AAAGAGCAAGAAAAGCGGGAGGAAGAGGAGAAGAAAAAGAAATTGGAAGCAGAAGCCGCC
GCCGAAGCAGCTAAAAAGAAAAAGCAAGAGGAAGATGATACGGGATTCGATATGTTCGCT
GATAATGAGGAACTTCCACAAGACAGTACAACAATTGATGGGCATAGTGGAGCAGTACAC
GACACTTTGAAAGATAATTGGGATGATGTAGAAGGATACTATCGTGAGTTGTAATTTTGA
TTTTATATAGGAAGTTTGTCTACTTGTTATATCTTCCAAAGTAAATATTTAATTTTCTGA
TTTTCAGGCGTAAGAATTGGAGAGCTCCTAGACACACGTTATCGTGTTGTTGGTTTCACT
GGTGCTGGTGTTTTTGGTAATGTATGCCGATGCAATGATCAGACAAAAGGAAACACTGTT
GCTGTCAAGATTATCAGAAACAACGAAGTTATGTACAAAACAGGACTCCGTGAACTTGAA
GTTCTTCGAAAATTGAATGAAGCTGACAAGGAGGATAAATATCATTGTCTTCGACTGTTC
AGAACTTTCAAGCATCACAATCACTTGTGTCTAGTCTTTGAAAATTTGAGCATGAATCTA
CGAGAACTTTTGAAAAAATACGGACAGAAGGATGGATTACATTTAAAGGCAGTTCGAAGT
TATGCTCAACAACTACTTCTGGCTCTGCGTCTTCTCAAAAAGTTGGAATTCGTTCATGCT
GATATTAAACCTGATAATATTCTTGTAAATGAGTCGAAGCTAACATTAAAACTTTGTGAT
TTTGGTTCTGCTGGTCGCGTCAATGAACAAGAATTGGCCCCATACTTGGTCTCTAGATTT
TATCGTGCACCAGAAATTAGTGAGTTTTAAATTAAAATTTTGTTCCCAGAAATAAAATAC
AATTTTCAGTGCTCGGAGTCCGTCATGACTATGCAATTGACCTCTGGTCCGTTGCAGTTA
CTCTCTATGAAGTTTACACTGGAAAAATCATGTTCCCAGGACGAACCAATAATCATATGT
TGAAATTGTTCACTGATGTCAAAGGAAAATATCCCAACAAATTGGTTCGAAAATCGCAAT
TCAAAGATACTCACTTTGATGTAAACTGTAATCTTTTGTATCAAGAAGTTGACAAAGTTA
CAGAAAGAAACAAGGTTTGTATATTTGAAAACTCAAAGTATTTACATTTTTATGTTTTCA
GATTACTGTTCTTGCAAATTTGAAACCGACACGCGATTTGGAATCAGAATTGATTGCCGG
GCAACGTTTGAGCAGAGACCAAATGGATCAGGTTAGTGTACCTTATAGTGCAGCTGGTTA
GACTATTGTCGACCACCCAAATGTCCCTGGTTCACCCCCGCTCTATGTTCCTCTCCACTT
TGTTAATTTTCTGGAATGGAGATTTTATAAGAGCGAAAATAAAATGTCATTAGCGGTGCT
CATCTTCGGTTAATTTTCTCGATATGGCTGATTGGATAATGACTACATTTTTATTTTCAC
AGATACAAGCGTTCCGAACTTTGCTCGATGGAATGCTGATTCTTGATCCAAGCAAACGAA
CAACCTGCAATGAGGCTCTCAAACACCCATTCTTCACCATACCTATCAAATAATACATTT
CCCAAATTTTTTCGGTGATCTCTAATTTCTCTTCTCCTATTTCGATTGTATGTATGCTAT
ATTTAAATACATATTCCTCGACAGCAAATTTTTTGTTATCTTTCGATTCATTATGGAAAT
TTTAAATGAAAATGATTGTAAATTCGCTACTTGTTTTGTATACATACTAAAAAATAAAAC
CAAGAGGCTAGACAAATTAGCAGTTGAGGTGTTGGATCTTCATGTCCTCTGCCTTCGTGG
CGTGCGAGTTATAGAATCGGTTTCCACAATATCCGCAAGCATGAACTCCTGGTTTGTCCT
GAAAAAATTAAAGTGTGACATTAAAAGTTAAAAAAAAACTAACAAGGTTGATGTATACTT
TCGGATGTCCAAGAGCTGGATGTCCTCCATCACAGAAGACAACTCTCTTATCCCCGCAAT
CCTCTGGAGGGCGTTGATCAATAAGATGCATTGCTACATTTGGATTGACGCTTTTCTTCG
AAATATCAAATCTTTGAAGACGATAATCAGATTGATCCCACGCCTGAAAATGTGCTTATT
TTATTTGAAAAGTTATATAAGAAACACTTACTTGTCCGGTGTGAGTCACCTTGTCGAATT
GTGCATTGTTTTTGGTAATTTGATTCGGAGTTGGTGGCTTTGTTGTAATTGTAGAAGAAG
CTCGGACGGCAAGAGGTCCGCGTGAAACCGACTGTTGAAGAAGCCGGTTCATTACTAAAC
CAAACAGTGATTATGATTAATCGATACAACTTTGAATTCAATATAAAAGAGCAACGAAGA
AATAATTGTAAAAACCGTAACAATTTCCTTCTTTATAAAACATGAACAAACATTGTTTTA
TACTTAAACTAGACAAATTGTTGTTAATCATCTGTTTTCAAACAAATTTGACGTCAATTA
AAAAGATGTTTCTCAACGCCCGCAACTTGGCGTCAAATGAAATGCTTGCGTCAAAAACAC
GAATTACCATTGTGCACCGTAATGAATCTTCCACATCGTTTTCTGAGTGATTTGTGAACG
AATAAATTAATTTGACCCGTCAAATTTTAAATAGGATACATGTTTATTCTAAGATTGTCT
AAAATTGATTTGATTTTCAGCTAGGGAGGCATAAATTTAAAGTAAGAGTTAAGACAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1148, 1192..1835, 2074..2211, 2262..2682, 2767..3318, 3369..3613, 3661..3750, 3962..4218
1022..1148, 1192..1835, 2074..2211, 2262..2682, 2767..3318, 3369..3613, 3661..3750, 3962..4069
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved