Caenorhabditis_elegans Locus frs-1
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans frs-1
Caenorhabditis_elegans
frs-1
I
T08B2.13
2763..2891
4601
CGCTTGACAGGTCTCGCATGGAAGAGAAAGAGCGGTGTAGGTTTACGAGTGACATTATT
TCATTTCTTCATTTTCAGGAACGTCTCTTATAGTTTTCCTGAAATTTCCATATTCTTTTT
CAAATATAAAATGATTTTTAAGTTACTTTGCTTCCATTATATACTGCCGCGTGTCTATTC
TTCCAATAATTGGCTGAAAAACTTTTGTTTTATTGTAAAAAGCTCCATTTAAATTCATAC
CTCTCTGCAAATTATCTCTATCATAAGGACAAACAATACAACTGCAAAAAAGCTGAACAC
AATCAGACCATCAGTAACTAATTGATCAAAAAAATTGATTTTGTCGAAGAGTACTTGTTT
TTCTGAAAATTTAGTCGAAACCTAAAGAGTCCTCCCTTTTTTAGTTTTTACCATGACTTT
CAAGTAGTTCGCATTATTGCATAGAGTGTCTCGACAACAACACGATTTTATTTCATCGAA
TATAAAAATTCCATTTGTGTCCTGAAATCACAGGAATATGAAATTAAATGCCTGAGGCGT
TACCAAATTGTTAATAAATTCTCGTTTGTTGGACGTAGGAGAGCAAAGAAAATTTGTTCG
CCAGTGTGTAGTGTTCATACATCCACTGTAGACAATTCCATCAATTATATCTGTCTTGCA
AGCCTGTTACAAGTTAATTTGATTATGAATCGTTAAAACTCTCACATTGAATAGCGAAGA
ACCTTCAGTGCCATAGCATTTTTGTCGTTCTAGATTGAATTGTCCATTGAGAATATTTTC
CACTGGCTCCGAAATGTGATAACACTCGAAAGCTTTCTGAAAATCATAGTTTTCCAGTAA
TTTCTAACTCGATTATTCACATATTCACGCCACTGATACGAATATTCGAAACAAATTAAC
AGACACAATACAAAACTCCACATTTTAAATGAAATATACCCATTTTCTTATTCGTAATGC
CTGATCTCATGTCACGCAAAATTTCAATATTTCAAATTCAGTTTTTTTTCGGATGACCGA
TCCGGATCGTCTCAACCAAATTCTACAAGATCAACCATACATTGAAGGGTGAATTTTTGT
AAATTGCATGAGTATTGTATTAAACGTGTGATGTGCTTGTAAAACTAGTATTTAGAGGTT
TGTTCTAAAAAGTAAAAATTGAAGGTTCGTGCAACCATCGGCCGCCGATTTCTCTGCGAG
AGCTTCGATAACAGAAAAAGAATTGAAAGGGCGAGAGCATTTGGAACGCTGGTTTCAGCA
TTTATCATCTTTTGAGTAAGATATCCATATCTAGCTTCTTTCATTGATTTCTTACTGTTT
CTTAGTTTTAACTTCACATTTTACTCAAGTTTACATAATTATTTTTTTTAGAATGACTGC
TGAAACTGATGTCCGATCAACGGAGAACCTACCCCAACAAATCCTCGATTTCCTTCAAGA
ATCGAATGAATTCAACTCAATTCAACTCGCCCAGCAATGGAATCTCGATCATCAGAAAGT
GATTGGAGCAATCAAAAGTTTGCTTGCAAACGAAGGGGTTCTTACCACCAAAGATGTGAC
CGAGAAACGGCTGGAATTAACTAACGAGGGAGTACAGTTTGCTAACGAAGGTTCGCCGGA
GTACCTCGTTTTTGAGTTTGTTGGAACTGATGGAGCCGCGCAAGCTGACATTCAGGTTAA
AAAAACATCATCAAGCGAAGTTTCTAATTCAATTTTTTCAGAAGAAACCATTTGGAAAAA
TTGGTATGGCGAAAGCTATGCAGTTCAAATGGGTTTCTGTGGATAAGGGACGTGTCGTCC
GACAAGCCACTGAAGTAACTGATTCCACCAGAAAACAGCTCGAGTCGTTAAGAATTGGAA
GTTCCGATGTTAGTGAAAATGAGAAGAAGGAGCTGAAGAAGAGAAAGCTTATCAGTGAAG
TGTATGCATTTTGTCAATAGTTTCTAATATTTAACAGAAATCAAATTTTAGAAACATCAA
AGCATTGGTGGTTTCCAAGGGAACATCTTTCACCACTAGTCTTGCAAAGCAGGAAGCTGA
TTTGACTCCGGAAATGATTGCTTCGTAAGTTACTTACAATTACTTTTCTATAGGAAAACT
CATAATTTAGTGGTTCATGGAAAGACATGCAATTCAAAAAGTATAATTTCGATTCACTCG
GAGTTGTTCCGTCATCTGGGCATCTGCATCCATTAATGAAAGTGCGGTCTGAATTCCGAC
AAATCTTCTTCTCAATGGGATTTTCTGAAATGGCGACAAATCGATACGTGGAGTCGTCTT
TCTGGAACTTTGATGCCCTTTTCCAACCTCAACAGCATCCTGCAAGAGATGCTCATGATA
CTTTCTTCGTTTCTGGTTAGATTCTTCATATCGTTTTTGCATCTTGTTCATTTTTCAATT
TTTCAAGATCCCGCGATTAGCACGAAGTTCCCTGAAGATTATTTGGAGAGAGTAAAAACT
GTTCATTCGAAAGGGGGATATGGTTCCGCTGGATATAACTACGACTGGAAGATTGAAGAG
GCTCAGAAGAATGTTCTTAGAACCCATACAACCGCCGTATCTGCTCGGCAGTTGTACCAG
CTAGCTCAGGAAGTTAGTCGACAAAAAATTTTGGGTTATTGGGATAGTGTGTGTCTTGTG
TACTACTCTCACTGTCTGCCAATGTCTACATGATGAGAGGTTGTGGGGGGAAACTGCACT
CATGGCGCAGTTGGGAACACTGGCGACTAACGGTCAGCAGGTCTCTGGTTCAATCCCACT
GTGTGCCCGGTCTTTGCCCCGGATCAACTTTAATAGTTATGACGGTTTCCGACTCGGGAA
AATAGATTCTTGCATAACGACGGAAATTTCAGAGTTTGTTCTGAATGTCTCCAGTCGATG
TGCAATACAATTTTATACTTTTTATGTAAAAAAAATGCGATTATAAAACCTTATTTTTTC
AGGGTTTCCGTCCATCTAAACTATTCTCGATTGACCGTGTTTTTCGTAATGAGACTCTCG
ACGCTACACATTTGGCCGAGTTCCATCAAGTAGAAGGAGTAATTGCTGAGAAAAATCTCA
GTTTGGCTCATCTTATCGGAATCTTCACCGAGTTCTTCAAGAAATTGGGAATCACCAATC
TTCGTTTCAAGCCAACATACAATCCATATACCGAGCCGAGTATGGAAATTTTCGCGTACC
ATCAAGGACTTACTAAATGGGTGGAGGTACGTACTAAAATCAAAATCACACGAGAATCAA
TAAGATTTAGATTGGAAACTCTGGAATGTTCCGCCCTGAAATGCTTCTGCCGATGGGTTT
GCCAGCTGATGTGAATGTCGCTGGTTATGGTTTGTCCCTGGAGCGCCCGACAATGATTAA
GTATGGAATTAACAACATTCGTGATCTTTTCGGAAGCAAAATCGATTTGAATGTGGTCTA
CAATAATCCAATCTGTAGACTCGACAAGTAACTTATTTAATCCTTTTTTTTGTTTTTGAA
ATTTCCGGTTATCATATCCTCTAAATATATTGCTTCTCCTTTTTAATTATTTGGAAATTG
TTGGGTTTTCCTTTCTCGTTTTTGTTGTAGCCGAAAATTATTATAATGAAAATGCTTGTT
TTATACAGTTCAATGTGTATTCTCTTATTAATATTGTTACATTTATCTATCGCTATCTTC
TTTTCAAATAACTAATTTTTAGACTTAATAACTTATTTACAGAATGACAAGCAGATTAGC
ACGCCTTTGGCAACCGGGAAATCCACAACGACGCGTCTTTCTTCCAGATTTCTGGATGGC
TGTGGTAGAATCACCAAGTGTTGGAAGGAATCGACTTCCGAGGAATTGTGTTAAATTTGA
GGTTTTTTCCACTGTTTTTTAAAAGTGAATTTCCATAATTGTAGGTTGATCCGCGAATGT
CTCGTCATGATATTCGTGAATATCTCACAAAAATTTACGATTTACCGGTTCGTGATGTGA
GAACAGAAGTTCAAATGGGCGATATTACATGGAATTCAAAACTAGATCATCAATACAAAA
AAGCAATGTGGAAGGATGAGGATAAAAAGATTGCATACGTGTTCATGTCAAAAGGTTTCG
AATTCTCATATCCACAAATGTTCGAGGCATTGGAAGAAGATTTGGAATTAGTGAAAGCAA
TGAAACAACAAGAAGAATTGAAGGATAAACTCAATGAGCGATATGCCAATAGGAACAGAC
GTGTTGGACAATTCCTTGGCGCTTAATTTGAAATCTTCTGTATATTTGTGTTTTTGATTC
ATTTTTTAGGATCTTTGTTTTGTTCGTTTCTGCTAGATCAATAAAATTTTAAAATCTTAA
ATTTATTTTCTTTTTTTAAAAATGTTATTGCCGTAATGCAACGATTGCTGAATTATTTTA
ATCATTTATTTCATTCTGAAAAGAAACACAATTTTACTTTCTAAACGTACTCAACTATTC
TAATCGAAAAGTTAGAAAGTATAAATTAAAGCGATCTACAATGTTTTTTCATGACGTTCA
CGGGCGGTAATTTTTCGTGAGATACTTTGTACTTTGCCCCCTTCACCTCTATCGTTTTCT
GTAGCCACTGTGTTGTCTACTATCTTGTAGTCCATTTTTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1164..1274, 1371..1674, 1721..1920, 1971..2063, 2110..2354, 2407..2591, 2942..3205, 3250..3601
1372..1674, 1721..1920, 1971..2063, 2110..2354, 2407..2591, 2942..3205, 3250..3447
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved