Caenorhabditis_elegans Locus rpl-4
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rpl-4
Caenorhabditis_elegans
rpl-4
I
B0041.9
1187..1240
3325
TAGCGAGCTAGAGTGTTGTAGGCGGATTTCGGAGTCTGAAAATAAAATGATTGTTTTTA
ATTTCAAAATAAATTATCAACTTACCAAACTAATTTCCTTTCCAATGACCGTCCCAACTG
GAAGATCAGTAAGTTTCACAGATGCCAGACAATTTGAGCGCATACACTCCAGAACCATCA
TACGATCGGGACGTCCTGGATCAACAACTCGAAGCATTCGGCATCCACAATGAGAGCATT
GTTCTTCTGAAAACATACTGGTGTTCGAATCATCGTCCATTTTTCTTTTCGCATTTCTTC
GAAATCCTGATGATTCAACTGACGATGTCGACGGTGTTGTGGAAATTATCTCACCTGAAA
ACTCAATTATTTAACAAAACATATTATTGTAAAACACATACCAACTGTTTCAACGTCGTT
CAATTTTCTCAGCGTATCCTCATTTACACGGAAATTTTTCATCTGTGCCGCTTTCCGCAA
TAATTCCATTCGCTTGTAGTCGATTTTCACGAGAGGAAAGAATGTTGATGTAGAAGACAG
CATCTATCCCAAACACTTATGTATTGAAACAAGTAAAAACACAATTAAACTATTTGAAAA
CGTTTTTAAGCAAGAAAATGGAAGGATCGGGTTTGAAATCAGCGGATACCGCGCCCTCGT
AAATTGACACAAGTTGCCTGCCGACATTTCGTCTCATCGCGGCGAGACCCCGACGTTGGA
TACTCAGCCAATACCCTAATTTTTGCCTCCCTTTAAACACGATTTCCCTGTTTTCTGAAA
TTTTTTAGGAACTTTTTTCGTTTTTTCAATATAAAAAAGATTTTCGGTGATATTTTCACA
TTTGGAATGTATTAAAATAAGGTTTTGAATATCCTAAGCCTGTTTCGGTCGAAAAATCTG
AATATTGCCTAAAATATCATCATTTTTTCTTTACTCTTCTCGCATTTTTTGAATCATTTT
CTTTTAAAATTAATCTATTTTTTACTATTTCTGTTGATTGCAGGTAATAATGGCGGCCAG
ACCGCTCGTGACTGTGTACGATGAAAAGTACGAGGCCACTCAATCTCAAATCCGGCTCCC
AGCCGTTTTCCGTACTCCAATCCGCCCAGACTTGGTGAGCTTCATCGCCGATCAGGTCCG
CAGAAACAGAAGACAGGCCCATGCCGTTAACACCAAGGCCGGTAAGTGACATAATTAGAT
TCGGTTATTGATTATTTTAATTTCAAACTAACTTCTGTGTTCCTCAATTACTATTTATTT
CAGGAAAGCAACACTCTGCTGAGTCCTGGGGAACTGGACGTGCCGTTGCCCGTATTCCAC
GTGTTCGCGGAGGAGGTACCCACCGTTCCGGACAGGGAGCTTTCGGAAATATGTGCCGTG
GAGGACACATGTTCGCCCCACTCAAGGTGTTCCGCCGCTGGCACCGCAACGTCAACATTG
CCCAGAAGAGATACGCTGTTTCCTCAGCTATTGCTGCCTCCGGAATCCCAGCTCTTCTCC
AAGCTCGTGGACACGTCATCGATCAAGTAAGTAAACTTTTTTAAAAGTTTTGTTCCTATT
TACAGTACTATTTTTTAGGTCGCTGAGGTCCCACTTGTTGTTTCCGACAAGGTCGAAAGC
TTCCGCAAGACCAAGGAGGCCGTCGTCTTCCTCCGTCGCTCCCACTTGTGGGCTGATATC
GAGAAGGTATACCATTTAAAAAAATTAAATTTGTTTTTAACGTAACAGTTTTAAGGTTTA
CAACTCGAAGAGAAACCGCGCCGGAAAGGGAAAGCTCCGCAACCGTCAACACAAGCAGAA
GCTCGGACCAGTTGTTATCTACGGACAAGATGCTGAGTGCGCTCGTGCCTTCCGCAACAT
CCCAGGAGTCGATGTCATGAATGTTGAGAGACTCAACCTTCTCAAGCTCGCCCCAGGAGG
ACATCTCGGACGTCTTATCATCTGGACCGAGTCTGCCTTCAAGAAGCTTGATACCATCTA
CGGAACCACCGTTGCCAACTCTTCTCAACTCAAGAAGGGATGGTCTGTCCCACTCCCAAT
CATGGCCAACTCCGACTTCTCCCGCATCATCCGTTCCGAAGAGGTCGTTAAGGCTATCAG
AGCTCCAAAGAAGAACCCAGTGCTTCCAAAGGTCCACCGCAACCCACTCAAGAAGAGAAC
CCTCTTGTACAAGTTGAACCCATATGCTTCTATCCTCCGCAAGGCTTCAAAGGCCAACGT
GAAGAAATAAGTATTCTGTTGTTGATAAACTTTTTTGTTAATAACCGATTTAATTTGTTG
AACGCATTGTTTAAATTTCCAGAACGATTTACTTTGACAACAGATTTATTTCAAAAATAA
TTTAAATATGATCATAAGCTGAGCTGCTAGGGTTATCACATTTCCGAAACGATTTGATGT
TCCGATCTATGCGCTGTAAAATATCTTTCATAGATTTTTCTTCTCGGCTACTGTCGACCC
GTTCAGTAGTGGCAGGCACAATTTTGCATTGAGTTTCTTGCAAAGATGGTTTGAGATTAG
GTTGTTGTGAATTGAAAATGGGTATTCTAATGAATTGCTTCATGAACAAGGCGCTGGGAG
ACCAAAGCTTGTTTGCACGAACGAGAGATGAAACCTGAAATCGTACATGAACAACAGATA
AGGAGAAACAAATGGAACCAACCGAACAATTATGCTTTAATGCTATTCTTTCAAGTGTAT
CATCGGTTTGAACTTGGTAAATTGTATATGAACATGGTGTAACTGGTGAAGATTGACTTT
GGGTTGTGCCGTATCTTCGAACCTGTAGAATCACATTTTAAATGTGCTGTGAGGACCGAT
TAAGGATTTTGCTTTAAGTTATAGAAAATGATCGAATATAACTGTAAAATTATTTTTAAT
GAATTTTTCAATTTTGCAAAAAAACTAATGCAAAAACGAAAACTCGATAACCCGGAAGAA
ATCAAAATTTTAAAGAGAAAATCAATAAAACCATTGAATTTCGAGAGGGAATTAATAAAT
AATTAGTCTTTTTTTTTTGGAAAATAGGAAAATCCATTTTAAAAAGTTAGAACATTTTTG
TAAATTTTTGTACAGTTATATTCCTTCATTACGGTCTATTTTCTGTCCTGTAAGATTTTT
TGCGAAACTTTAGAAAATCGAAAAACGATAAATTTTGGATTTTTTGTTTTTTTTTTTTGA
TTTTCCGGAAAAAATCTACATACCCTATTAAAACCAACAAGGAATGTGCTTTCGTCTGGC
TGACAAAACTCTGTTGCTGATGACGACGACGGTGGTTGGATCGTCATCATTCATGGTTTA
ACGTCGTTCTCCGTTTTTACTGAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1180, 1263..1525, 1578..1685, 1735..2325
1009..1180, 1263..1525, 1578..1685, 1735..2229
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved