Caenorhabditis_elegans Locus rpn-8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rpn-8
Caenorhabditis_elegans
rpn-8
I
R12E2.17
1681..1748
3956
ATCAACATCAGATAATATATAATGAAATTTAACTAACTCACCGTGTCCAGGTCATGTGT
CAAAATAGACTTTGTTTTCTGTCTAGCTTCCCGAGACATGTGCGCCTTGAAGAGGAAGAA
ACTGCAAAGAACAAACAATTTTTTTAAGATATATAGTTTTTAAATATTACTTTGAAGCGT
AGACGGGCTCATTTGTCTGTTTGGCCAGCCGTTTATACGGTAAATCTCGATGACCCAGTG
ACTCAACCTTTTCAATTACTGCTCCGTGATCCAGCAAAGTGTTTCCAGCACGCGTTAAAG
CTTTAACAAGATCTGCCTGAAATAAAGAATATTCTCATGATTATACACATTCTCACGCTT
CATCGTGTTTTTTCTGTACCTTTGACAGAGATCGTGTGATCATGCTCACTTCATAAAACG
GCATTGTTGTTCTCGCCCAGTATGAATGCTTTTTCTTCACTGAAAATATTTTCTATGCTA
CGAATTTGGAAATATGTCAATGAAAATCACGATAAGAAATCACAGCACAAGCTATTTTTC
CAAAATAGGAAGTTGCCATTTTTCAACGACAGGCTGTGAACACAAGATTATTAAACAAAA
ATTTACTAGAACAATAAAATAAATGTTCAATTTTCAATTTTTCGCATTAGAAAGTTAATT
TTCCGTCATTGCAATCGAAAAAAGTTAATTTTAAAGTAAAGAACCAGGAAAAATAAAGTG
GAAATACGGGATGGGTCTCACCACGGCCAGTGTCGATTTACGGGGAAATTGCATGCGCCT
TTAAACGATGATATTTCTTTTTTGAACGGGAAGCGGGAAATTGTCGTTTTTAAGCATTAT
TTATTTATTTCTTTTCATTTTTTCATTCAAATTATATTCTAGATACGTTTATGGCAGGTT
TTTCCGCAATGATTAAGCGTTTCTCACTGTTATGTCGATTATTAACGTGTTAAACTGTTA
TGTGTTGATTTTTTATTGTGATAAATTTATTTTCGTTTTTTAGAAGAATGGCTCCAACTA
ACAAAGACGGAGATGTGGCGACTGTCAAAGCTGTAGATGTTCTCAAACAAAAGGCTGGAG
CCCATCATTGCCTTGGAAATGTTCATGCAAACCTTCCCGTTAATAAGGTTAGCATACCTG
AGCGAGAAAATTCGATTTTAAATAAACACAATTATTTAAGGTGACCGTCCATCCATTGGT
TCTTCTGAGTGTTGTTGATCATTTCAATCGTGTCAGCAAAACTCAAAGCGTGAAGCGTGT
TGTTGGAGTCCTTTTGGGGTCCATGAAAAAGGACAAAACTCTGGATATTGGAAACAGTTT
TGCTGGTATTTTTAAAAATTTATTTGCTTACTTATAAAGTAATTTTCAGTTCCGTTTGAT
GAAGATGACAAGGATAAAAGTACATGGTTCCTCGACATGGACTATTTGGAGAGCATGTAT
GGAATGTTCTACAAGGTTGGTGAATTTTGAAATCTCGTTTTTATTTAATTTTAAACAAAA
AAAATGAATTTACAGGTTGCCGCCAAGGAAAAAATCGTCGGATGGTATCATACGGGTCCA
AAACTTCACAAGGTATATAAGAGGCAAAAAAGAGACGGGGACAACGCGCGTAGTGGTCTA
GTGGCTAGCAGGCACACACTCTGCGCCTCCAGCCATTGGTTCGATTTCTCATTCCACTCG
GGTTTGTGATGACTGCATACGGATCACTGGGCTCTGAATCTCTATGAACCGATAATATCC
GTTCTGATACCCGTTTTTACGGTTTCATGATCGATGGAGCGCGAACTTGTTTAAATTTGA
AATTATACTGTGCAAATAACAACAAAGCAAAAAAAAAAAAACTTAAAACAAATCAAATCA
AAACTTTTGAAAAAAATCGAAAAAAATGCAGTGGATACCTGACAAAAAAAAAAGAAAAAA
CCGTGTCACAGTGTTGCGAAATTACGCTCCGCCTTACTTTCTGTGCCACCCTGATTTTTG
CAAAATTACGGTGTTCAACTTCAACAGTTTAATTAATTATTTATTTATTAATTTTACAGA
ACGATATTGCTATCAACGAGCAATTGAAACGATTCTGCCCGAACCCGGTTCTTGTAATTA
TCGATGCTGAGCCAAAGAACATCGGATTGCCAACAGAGGCTTACATCGAAGTTCAGGAAG
TTCACGATGTACGTTTCAAAATACTGTTTAATTTTTTTTCAATATATTGTTTTGTAGGAT
GGAACTCCACCAATCAAAACCTTCGAGCATGTGCCTTCAGATATCGGAGCCGAAGAAGCT
GAGGAAGTTGGAGTCGAGCATCTTTTGAGAGATATCAAGGACCAAACTGCTGGAACTCTT
TCACAGCGTATCACCGATCAACTTATGGGCTTGAGAGGACTGCAATCACAGCTTGAATCC
ATTGAGAAGTATCTTCATGATATTGTGCGCGGAACTCTTCCAGTCAACCATCATGTCATT
TACTATGTTCAAGAAGTTCTCAATCTCCTGCCTGACGTCACTCATCCAGACTACATTGTT
TCACAGAATGTGCAAACTAATGATCAGCTCATGTGTGTGTATATGGGATCTCTTGTACGA
TCGGTGGTCGCTTTGCACAACTTAATTGATAACAAGGTGATTTGCAAAGATTTTAAAATT
TATTAAAAGCTATGATTTTTAGATCTCTCTCCAGAAGGCTGAAAAGGAGCAGGAAACTGG
CGAAGCTGAGAAAAAGAAGGATGAAAAGGATAAGAAAGACAAAAAGGATGAAAAGAAGGA
TGAGAAAAAGGAAAAGGACAGTAAATCATCAACCCCTAATACTCCAAAGAAGTGATAAAC
AAACTCAGAACATTGATTGTATCCTCATGTCCACTTCTCCACCAATCTCTTTTTCTTTTA
CCCTATCGCATCATATACATTTAATTTATTCGGTCTTTTATTTTTCTGTGCATCAATGTA
GTATTTTATCCCCGGTATTTAGATCAGTTGCCAATAATTTTTCAGAAGACAAAATCTAAT
AACTTTATTAGAAAAAATAACAAAGATAACATCCCCGTAAAGCAATGGTAAATATCACGA
AGAAAGGCATGGCTTATTAAATTAGGAGTATCCAATGTGGATTTAAAGATCTTTTTGCTG
ATGCTTGATGTAAATGCCTTCGGCAACTTTCCATGCACTTCCACCAGTGATCGAGTCGGT
GCCGACGACCTCCCGTTGTCCATGAATGGGGCGTCCGAATTGTTGTCCCGAGAGTGAGAG
GTATGAACCAGTGACAGCGTGGCGAAGTTTGAATTGCTAAAGTGAACAATATAGGGTATT
CAAAACGTATAGATAATATCGAAAAGGAATGTAACAAACCTCGGATTCCAACCACTCATC
TCCGTTGCAAATCACAGTCCAATCATCTCCCGTGTCACTTTCTGCTTCGCTGCCAAAAGC
GGAGACCTCCTTTAAAAAATCAAATTATTCATTTGTTTTCTCGAATTGCCAAACAAACCT
GATGTTGTTTGGAGAGAGGTGCAGTGAAATGATGGGAATGCAGGAACGTGCCCGTGGTGA
GGTGCTTCAGACGGATCTTGTCTCCGCATTTGATTGCATCTCCACGATTGCATTTTGCGT
TCAAAGCTGAAGTAAGAGAATGTTCGGTTTTCTTTGTTCTTTTTTTTCAAAAAGCATTAA
TATACACAAATTATTATAGTTTAAGTTACTAGGCGTTAACTTCCAAATAACTAACCTGGG
AAAATCTGCCAATGAGAATTGATGTCGTCCGAGTTTTTTACAGCAGTCACAGATTGTTGG
CCGGACCCGCTTCCGTATTTTACGTCATGCGAATGTAACCTGAAACCTTTTTGTTTCAAA
CAAAATCTACTTTTTCGAAGGGAAAATGCTCATTTTCTCAGGAGATATTCTTTAATATTT
ACTGTTGGTGGCAACTATTTATTTAGTGTCATTAACTTTACCGAGTTTCTAATATTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1126, 1180..1324, 1369..1454, 1515..1571, 2039..2167, 2217..2615, 2662..2956
1007..1126, 1180..1324, 1369..1454, 1515..1571, 2039..2167, 2217..2615, 2662..2811
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved