Caenorhabditis_elegans Locus E01A2.6
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans E01A2.6
Caenorhabditis_elegans
E01A2.6
I
E01A2.9
1223..1349
3787
GAGCCCATTTTGAGGTTGTACCTTCAAAATACCTAGAACCGTTACTTCTCCTTTAAGTT
TTTTTTTGATAAGCCAAGATTTCCATTGCAAAAATCAAATTCTTATTGTAACAAAAATTA
AAACGGATAGAGAAATATCTCTCTCCGTCTCTTCGTCATTTCGAAAATGATCAGTTTCGT
TTTCTGACGAAAAAATTAGTTTATCTTCTTTTTATCTCAAAATCACGGCTTCAAATATAA
AAAATCACTGCTATTTTAAAAGGAATTTTGAATTTTTGAAAAAATGTTGTATTTTTTAAA
TCAAAAATTCGGAGTAATATATTTAAAAATTGACTTTTTTCATTTTCATCAATTTTAGTT
GCAATAATTACCGAAAAACCCTGCAAATTGTCGCATTTCAACGAAAATTCCGTTCGGAAA
AGGATGGAAAATGAAGAGGCGTGGTGGGCGGTGTTTGAACTGGCGGCGCAGTTAGATCTG
CAGGTTCTCTCTACCGTACCCCTCCTCCCCTCTCCCTCTCTCTCATTCAGTTCATTCATC
GATTTTCGCATTTTCCTATCGACTCATCCGGCGTTCTGTTGCGTGGATTTTCGTTGATTT
TCTTAATTATCGCTCGATTTAGGCCAGTTCTCTTGAAAAATATTGGAAAATAGCATGCCA
TTGTGTTGTTTCAAGACGCTTTTTTCTTTCGCCTGACGTTTATCGATTTTTGGGTCGATG
TGTGGCCTCCCGCTGCTTTACACTACGACTAGTCTGCTCATTTCTTGCAAGATTTCACGT
CAATATTCTTAGTTTCTACCACATCGAAAAGATTTATCTTTTAAAAATATTGTGTTTTTT
CACGCGAGCAGTTCAAATGTTCTCCAAAATTGTCACTAACTCATTTTCTATCGATTATTT
CGTAAGATTGGCCTTTCTCGTATTTCTCGATTTTATCTCGAATGTCTTCAACTCTTGTGT
AAGAAATGTTACTTCTCGTAACCACAAATTATTTCTTTCAGAAGTAAAATGGCTTGCGGA
CTCGCACTGAAAAGACCTCTGCAACACGAGTATGAATCTTTTTTAACTGATGAGACATAC
AACGGAGAAGCAAAGCGAGCCAGAACGCAATGCCCTCCTTTCCGTGCTCAAATGGGAACT
ATTGCCGCTACACTGCCGTCAACCAGCACATTTGCTCAGAAGTTCAAAGAACAGGTAGAT
AATTGATATAATATGTTTAGATTTGTGTCATTTATTCCTCGGATAGTGATATTTGTTCCT
TTTCGAGCTCATACTGACACAAAAGCAATGGCAGATTTGCAACTAGTTGCGTTCTACTTG
ATCGTGGCTATACTTTCTTCTGACCACATTTATTTTACCTAATATCGAAAATTATTCATT
TTTCAGGAGGAAAGCGTCTTCCAAGCAGCTACACTTATGACTCGTTTGTCTCGAAATCAG
CTCAAAACATATCTCAGTTCGGAAGTGAAAAACCTGCGCAAGCGAAAAGCCATTCCACGC
AGCAATGACTTTGATGATGATGGAGATCAAAGAGGAGACGGATGCAGCTCAAACTACTCA
AAAGCTTACAGAGCTCCTTCTTCTCCCAAGGTAGGATTATAGCTGAGCTATTCTTTTAGT
TGTGTCTGTTATTCCTTTGCGAAATCCATTATTTCGTTGAGCTCAATCGGACACTATAGA
GACGGCAGATAGCAACTAGTTTGGTTCCTTGTCATCGAACCGGCTATACTTATTTCTGAC
TACAATTAAATTAAAATAGTATACAACAAATTTATCTTCAGTGTTTTGAAATATCTTCAG
TGTTTTGAAATTAACTATGGTTTTGTTAAAATCGAATTTTCAGTCTGGATCGGATTCCGA
GGGTGAAGCACCATCAACATCTGTGACTGATCGTTCCAGCGCCAAGAGGGAATTTACAAT
GGCAAATGTTCAAATGATATGCGAACGTCTGCTCAAACAACAAGAAATCCGTCTGAGAAA
TGAGTTCGAAATGGTTCTGACTAAGAAGCTTGATGGTAAGATTTTCCATGAATAATATTT
ATTTTATAATTAACGTTTTCAGAGCAACACCAGCAATACGTCCAATTTGCTGCCGAGCAG
CTGAACTCCAAATGTGTGAGCACTGGGGATGACTATTCCTATTCGTACCTCTCCTAAATC
AATCATGGTCGGCCGATAAAACAGCAAAACATCCGTTCATAATCCCAATTTGCTTTTTTC
TCAACATTTCAACAAAAATTTCTAAAACTAAATGAAGTTGAAACTACTTGCTTTTTGAAG
TCTTTTCTACTTTCTTTTTTTCGTATAATTTGAACTTTTAATCGTCATTCTCCCCCTCCC
CTCCACAGTTTCTTGATCACTGGTATGTTTCAAAGTTAAATGCGGTTTTTCTGATGGTTT
TCTCCCTCATTTTTCCGCTTCCCTCCACTCCCATCGCCTTTGACCTTTTCTTTTACCTCT
CAATAGGCATTGACTGTACGAGGTTTTTATTATGAAATTAAAAAGAGATTAGATTTTCGT
AGCTTCCTTTACACATTACAGCTTCTTTTTGGCCTTTTTTTGTGCTCGCACCCACCCTTT
CATTGTGAATGTGATATTATTTGTGAGCATTTCCACCTTCCAATCTAAAATTGACCCTGC
TCACTTCCCACCAATCTCCTCTCCCCTAATCGATAATTTTCGTTGTGTGACCATCTATTT
TATTATTCCCCCTTTTTCTGCCACTATGTTTCATTATCTCCCATTGCTACTTTTTCGCTT
TCCATCGTTTTAAATAAAGAGTGCTTCGAAGAATCGTTGTGGAAATTGCTTTAAAAAAAA
CGTTTATTCGATCAATACACCAAAAATCGAAATTCTCCCCTCTAGTCTCGAGAATTTTCA
GCGAAATGCAAGTAGTCGGACTAATTTCTGGTGGTAAAGACAGCTGCTACAACCTGATGT
GTGCCGTGCGAGAGGGCCATCAAATCGTGGCACTTGCAAATCTGCACCCACCGAAAGATG
CAAAATCAGATGAACTTGATTCATACATGTATCAAAGTGTTGGAGCAGATGGAGTTGAGG
TTGGGTCCTGCCACGAACCGAGATAGAAAAGGATGAAGAAACGACACCCTTTACCCGGAC
GCAGAGGATTTTTGTGCTGAAAATATGGTCTCGACGCGACATATTTTTTCTCAATTACAA
AAAGGTGCGCGCCTTTAAAGAATTCTGTAACTTCTATCGATTTTTCATAGTTTTCCGTGA
AAGTTTATTCATTTTTTTGAAACTCAAACGTCACAATGCATGAATTTTCAAATTTGAAAT
TAGAGTAATCTTTAAAAGCGGACACCTTTTTGCAATGAACAAAAGTTTGTCGCGTCGATC
CCTGTATTTATTCAATAAATCACAAAATTCCGCGTCTGAATAATTTAATAAATTTTAATA
AAAATGGATTTTCAGCTGTACGGTGAAGCCATGCAACTTCCTCTCTATCGACGAGAAATC
ACCGGTGAGCCGAAAAATCAAAAGTCGGATTACGAGAAAACAGATGGAGATGAAGTGGAG
GATCTGTTCGAATTGTTATGCGAAGTGAAAAAGCATCATCCAGAAGTAAAAGGAGTATCG
GCTGGAGCAATTCTTTCGAGTTATCAGAAAGTTCGAGTTGAAGACATTTGCCGGCGGCTT
GATCTCGTTCCACTTTGCTTTTTATGGGAGAGAGAACAAAATGTAATTATTTATTGTCAT
TTCACATGCCTTCTTAAAGGGACACGGGTGTATTCAGCTGGGTCTCGGCGCGAAAAAAGT
TAATGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 1386..1589, 1843..2014, 2062..2787
1008..1193, 1386..1589, 1843..2014, 2062..2153
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved