Caenorhabditis_elegans Locus cogc-3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans cogc-3
Caenorhabditis_elegans
cogc-3
I
Y71F9AM.7
5325..5460
17692
CAATTTATCTTGATTTGTTTTCCGCGTTTTTTCTTTGGTTTTTCACTGATTTTTCCCGT
TTTTTGTTATTAAAACTGATAAATAAATATTTTTTGCAGATGCTAAAACAATTTCCAAGT
GAAAAAATCGTGTATTGAGTCGGCAAGTAGCGGTGAAAATGGTCAAAGGATTACGGGAAT
ACTAAACCTAAACTTTTTTCCGAAACATGATACATATGTTGCTCAGAGGCTGAAACTACC
TGATTTTCATAACGAGACCGCTGAAAAAATTTTGAGATTTTCAAAATTCAACGTATTTGG
CTAAAAAGTCAAGATTTTCGCACCAAAAGTTGAATTTTGAAAATCTCAAAACTTTTTCAG
CGGTCTCGTTATGAAAATCAGGTAGTTTCAGCCTCTAAGCAGCATATGTATCATGTTTGG
AAAAAAAGTTTAGGTTTAGTATTCCCGTAATTCATCATATAACATTCACCACTTTCACCA
CTTCTTGCCGACTGAATGCATAATTTTTTCACTTGGGAATTGTTTTAGCATCTGCAAAAA
ATATTTATTTATCAGTTTTAATAAGAAAAAACGAGGGAAAATCAGTGAAAAACCAAAGAA
AAAACGCGGAAAACAAATCAAGATAAATTGCCGCTAAATCTTGTCGGCCCCTCGGCCACG
GCCAAGAAACCGCTTTTCCTCGTCCTTCGTTCGAAAAAAGTTGCAGTGTATTTTGAATTA
ATTTAATGAAAAAAAAAATTAAAATAAAATTTTTTTTTTCCAGGTGAAAAGCGACCGCTT
CCGTTACGTGGACTAAACGTGTTTCCCGGATGTTTCCCTGATCTGTGCCTATTTAATTCG
ATTTATTTTATTTATATTGTTGCATATCTTGTCCTGTTACTCAATGAATCTTCATCACTT
CATCAAGTTTCCAGAATTTTTTGAAATTATCGGTTTTCCCCGGCCATTTTTATCTTTTTT
TCAAAAATTTTGTTTCCGAGTCCCCCAGCCTCTATTTTCAGATGGAAATAGATCATATGC
GAACTGTGGAGCTTCTGGCTGCAAAAGCCGCCACCTGGGGTCTTCCAGAAGCTGTAGAAG
ATGCAGAATGTGGGAATTTTTTACCAAAATTGTTTTTTTTTATTTAAAAAATTGTTTAAA
AATATAAATCATTTAGCTGACACAGAAGAGGATGTCGTCGGACTAATTTCGGGGGCACTG
AAAGATATCAAAAAACGGGAAAAAGATCTTGCGGAGCTCCAATTTCCACCGGAAATCACC
GCGATTCGATCGAATATGAAACGATTCCGTGATCTGCAGAAGCAAATTGATAATTCTAAA
GCGGTAAATCGGACGAAAATTGTTATATAGATCCTATTTAAGCTTTTTTTTTTGAGAAAA
ACAGGTTTTTTGGGTTTTTGAAATCAAAAATAACCAAAAAATAAATTACAACACTGATTC
AGCAAACAAAAAATTAAACAAAAAGGAGCAGAAAAGCTTCCGTTTTTTTTTTTTAATATT
TTATGAAAAATTTCCATTTAAAATCAAAAATTAAATTGCTTTTTGATTTTTTTGAAAAGT
TCGATTTTTTGTTTTTTGGTCGAAATTTTTTTTGCAACAGCCCTGCTCCTGATACCGAAT
ATAAATGTGAAAAAAATTTTAAAAAAATTTCTTGAATCCGAAAATCGACAAATTTTGCCG
CCAGAGACTAAGCCACGCCCATGATAACCGTGCCGCAGTTGTGGATTTACGAGAGATTAT
TATTTTTCATCCATTTTTATTGAATTTTCACACCGATTTTTCCAATTTTTTTGTGGTTTT
ACATTGAAATTCCTATGATTTCCATCAATTTATGTTTTTTATCAATGAAAACAAACAAAA
TTACATGAAATATTCGATTTTCAGCAGATTTTCTGTAATTTTATTTGTTTTCATTAATAA
AAAGTCATAAATTAATGGAAATCATAGGAATATCAATGTAAAACAACGAAAAATCGGGAA
AATCGGTGTGAAAATTCAACACAAATGGATGAAAAATATTAATCTCTCGTAAATCCACAC
CTGCGACACGGTTATAATGGGCGTGGCTTAGTCTCTGGCGGAAAAATTGGTCGTTTGAAT
TTAAAAATATGATTTTTGGATTCATAAAAAATTAATATAAAATCAGGGAAATTTTTTTGA
ATTTTTTCACATCGATTTTCGGTTTCAGGAGCATAAATATGGCCTATTGAAAAATTTTGG
AGAAAATTGGCTCAATTTTTTAGAAACTTGTAAATTTTTTTAAAATTTAAAATTTAAATT
AAAAGTTAAATTTTTTAAATTTTCTAGACACCTTCAAATTAAAAAAACACTGAAAAAAAC
TTCTTCCAGACAATGAACGAGCTACGAGAAGCCTACGAATCAGTTTCCAGTAGAACTTGT
TCACTCCATGACGCTTGTGATCGGGCTCTCGCCGAGCAAACTTCGCTTTCCACCGGCTCA
CAGCTCATCAAGACTAATTTGTATTATTTCAAGCAAGCTGATGCTATTATGAAGGTTTTT
ACAAAAAATCCGTAAAAACGAACTCAAAGAAAAAAGAGTGCGGAGTTTGCAATTCCCTCG
CGCGCACTTTTTTTAAAAATAATTTAATTTTCAACTGTGGATTCTGGCCTTCCTCATTGA
ATATTTTGGCGCTCCATTGACAATCGCCTTCCGGACAACGCGTGGAAAAATGACGTGTAC
TCCACACGGACAAATACATTTAGTTTTACAACTGAAATCGAGCCGCGACGCGACACGCAA
CGCGCCGTAAATCTACCCCAGAAATGGCCGAGCCAAGATGGCCTAGTTCGGCAAAAACTC
TTCCATTTCAATTTATGAGGGCAGCCAGAAGCAAGGGTGCCATTTTTCGATTTTTCGATT
TTTTCGCGCAAAATCGAAAAATCGAAAAACGAAAATTTTCGATTTTTCGATTCCCTGGAA
AATCGAAAAATCGAAAAAAAAAATGTTCAGAAAATTAACCATAAAATATGATTGTTTATC
TAATTTTGTTTATATTGATACGAAAACACATTGAATTTTCTTCTAAAAAGAAGAATAATG
GCCAAAATATTGAGCTAATTTTTGAAAAATCGAAAAATTTCGTTTTTCGATTTTCTGAAA
AAAAAAAAACGAAAAACCGACACCCTTGGCCGCGACGCGACACACAACGCGCCGTAAATC
TACCCCAGATATGGCCGAGCCAAAATGGCCTAGTTTGGCAAAAACTCTTCCATTTCAATT
TATGAAGGAAGCCAGAAGACCGTGATTGTGAGGCTAAAAAATTATTTGACTTGAAAAATT
GAAAAGTGCGCGGGGATATTGCAAACGCCGCCAAAATTTTCCGGTTTTTCGGAGTTTTTT
TTTTTTTTGAAAAATGTTGGCGCACTATAAAATTTAAACAATTAAAAAAAATTTTCTCAA
AAAAAATCCAAAAATAATTCCAGAAGCTCTCCGTGGCAAAGCTTATGGTAACCGGACACT
CTTTCGCGGCAATATTAGTCTCAATTGACGAGTGTTTGACATATTTAAGAGCTCATCCAG
AATATAAAGAATCAGAAGCCTATATTTCAAAATTTGAGCAGTGCCTGAGCAGAGCAATGA
CTTGGGTTCGTGTTGCTGTGCTCGCTGACTTGGAAGCTTGCTTCAATGCAGTCAAGGATA
GACAGGCTCAGTTGGAGGTAAAATATTACACAGACGCAGAAAATTTTGGCTATTTTTGAG
ATTGCCGTGGAATAAATTGGAAATTGGTGAAAAAACCCAAGAAATCCTAGTTTTTGAGCC
CAAAATGTAAAACAAAAATTAATTAAATTTAAATACTTTTCTCAAAAAAAAACCGAAAAA
AATCACAGCCTAGGTGAAAACACCGGGCTCGTTAGGTATTTTTCTCGGCAAAACTGCAAA
TTCGGATGTTTTTAGCCGTGGAGCGCGTTTTCTGCAAGGGCTGTGCTTTTTTTTTCGGTT
TTTTGACACCAGAAAATCCAAAGAAAGTCCCCAATTCATGCGAAAAAAATTTAATTTGCT
AAAAAAACCCCAAAAATACCCGAATTTTGATATAAATATTTTTAATTCTTTTTTTTGAAA
AAAAAATCATTGTGAACTACATTTTGCTAATTTTTTTGGTTTTCTTGGACTCAAAAACCA
AAAAAAAAAAATTAATTTTTGTCAAAATAAAAAATTTTTAATCCAAAAAATCGATTTTTC
GTCTAAATAAAAATTTTTTGAATTCAAAAAATCAATTTTTCGTCAAAATTAATATATTTT
TGATTCAAAAATCGATTTTTGTCTAAATTAAAAAAAAAATTATCCAAAAAATCAATTTTT
CGTCAATATTAAATTTTTTGATCCAAAAAATCAATTTTTCCTCAAAATTAAAATTATTTT
AAACCAAAAAATCAATTTTTAAACCAAATTAAAAAATTTTTTATCCAAAAAAATCAATTT
TTCGTCATAAATTAATTTTTTAATCAAAAAAATTAATTTTTCCTCTAACTTAAAATTTTT
TTAATTCAAAAAATTAAAAATTTTCTTCAAAATTAAAATTTTGTTAACCCAAAAAATCAT
TTTTTTCGTCTAAATTAAAATATTTTTGGCCCAAAAAATAATTTTTTCGTCTAAATTTAA
ATTTTTTAATCCAAAAAATCGATTTTTCGTCTGAATTTAAATTTTTTAATCCAAAAAATC
ATTTTTTCGTCTAAATTAAAATATTTTTGGCCCAAAAAATCATTTTTTCGTCTAAATTTA
AAATTTTTAATCCAAAAAATCAATTTTCTGTCAAAAATTTAATTTTTTTTAATTAAAAAA
TCAATTTTTTTTAATAAAAAAAAAACAATTTTATGTCAAAAATTAATTTTTTTTATCTGA
AAAATTAATTTTTTTTTTCTGAAAAATTAATTTTTCTTCAGAATTAAAAATTTTTAATCC
AAAAAAATCAATTTTTCGTCGAAATTAAATGTTTTTTAATCCAAAAAAATCAATTTTTTG
TCAAAATTTAATGTTTTTTTAATCCAAAAAAATTGATTTTTCGTCATAAATAAATTTTTT
ATACCACAAAATTATGTTTTTTGTCAAAATTAAATTTTTTTAATCCAAAAAATCACTTTT
TTCGCCAAAATAAAAAAAAATCTCCCACAATAACCCGAATTTTCTTAAAATAAACAAAAA
TTCAGCTGGACTACGAGAAAATCGGCCGTGCAGGACAAGAAGAGGACACCTTCGCATTGC
TCTATGGTGTATTCGCATCGAAGGCGGCAGTCGTGAAGTGAGTTGTGTGGCCGAGTGGTT
AACACGCTCACCCGCCGCGCGAGACACCACAGCTCGACCCTGACACACGGCCAGTTTGAG
TTGATTCGCTCTTTCGCAATAGAGCTTTGAGTCAAATTACTGTCCGGAAATTATAGAGAT
GAAGCTCATTTGGAGCAATAACAATTGTTGAAGCTCCGAAAATGATGCTCTTCCCACAAT
TTTCTCTAGTTTTTTTTGTTTTTTTAAAAGAGATATAAAAAATATTTAATTTTACAAAAT
TTTCCAGAGCCTCAATAAACGTGGTCGAACAACGTTTCTCAGCTGTACCTGAATTCGAAG
AAATGCTCGCCGAGTGCCAATATGCATATTTTGCAAAACGAAATCTACTTCTCGGGCCAA
TTCTCGAATCGACACTTGCCAATCTTTCTGGGTATAATTTTTTTTCGCTTTTTTTTCGGA
AAACGTAAATCATAAATTTTTAAATTTTGCACTTTTTACAAAAAAATTACACAGGAAAAT
ATAGCTTACAAATTTTAAAAATTAAAAAAAAATCCATTTTTGGATTTTTTTAAATCGGTT
TTTGTTCCTAAAGAAAATTTTTTTGTAGTACTGTAAAAAATCGATAATTTTTTAATAAAA
ATCGATAATAATTTTTTTAAAATCAGAAATCCATAATTTTTCATTCAAAAAACGATTAAA
ATTATAGATTTTTGATAAAAAATTATCGATTTTTGATTGAAATTATCGATTTTTGATGAA
AATTATCGATTTTTAATTAAAATTATCGATTTTTGATGAAAATTATCGATTTTTAATTAA
AATTATCGATTTTTGATATAATTTTTTTGTAAAATTCCAGAACTCACGATGATTCGACAT
GTCGTTTGACTCGTGACGCATGCACATTCATGCTCCGAACATGTGACGATGAATATCGTC
TCTACCGTCAATTCTTTGTAACTCGACATACCGAAGAACGGAAACTATCAACTGACGGAA
GAATTAGTCCAGCAATGTCTACAATTACTTCTGTATTCACTTCTGCACAATCTCCACAAC
AAGTTCACCCATTTGAGACGTTTTCCGAGCAAATGTGCCGTACTTTGTACGATATGCTCC
GTCCGAGAATAGTTCATAATCCACACTTGGAAACACTTGCAGAGCTGTGTACAATGATTA
AAGTAAAGATTTCTAGCAAAAAATCGATAATTATTTCATTTGAAAAAATCTAAATTCCAA
TCAAAAATCGATAATTATTAAATACCATAATTAAATCTATTAATTCCATTAGAAAAGTCG
ATAATTTCAATCTAAAATCAATAATTTTAATCGAAAATCGATAATTTCCATCAAAAATCG
ATAATTTCCACTAAAAATCGATAATTTCCACCAAAAATCAATAATTTCAATTAAAAAATC
GATAATTTCAACTAAACACCGATAATTTCCATAAAAAGTTGATATTTTTCAATGAAATAC
AACAGTTTCCACTAGAAATCGATAATTTTAATTTAAAAAAAGCGATAATTTTAATTTTAA
AAAATCGATAATTTTAATCAAAAATCAATAATTTCCACTAAAAATCGATAATTTCATTCA
AAAATCAATAATTTCCACTAAAAATCGATATTTTTTAATTAAAACTCGATAATTTCGATA
TAAAATCAAGAATTTTAGTCAAAAAACGATATGTTCAATCAAAACCCGAAAATTTCCATT
AAAAATACAAAAATTTTGGATAAACAGTCGATAATTATTACTATAAATTAATCTATAATT
TCCACTAGAAAAATCGATTATTTTTTAATCAAAAATCGATAATTTCCATCAAAAATCAAA
ATAATTTCTATCAAAAATTGATAATTTTGATTAAAAATTTATAATTTTCGATAAAAAATC
AATAATTTCCACCAAAAATGAATCCACTAAAAATCGATAATTTTGATTTAAAAAATCAAT
AATTTCAATTAAAAAAAAAGAAAATTTTTCGTTAAAAATATATCGATTTTTCAATGGATC
CCTAATAATATGGAAATGCAAAAATTATTGAATTTCAGATTGAAATGATTGAAAATCGAT
GTTCACTTCAAATGGTAGCATCAATTCTTGGAGATGATGCATCAAATGATCAAAATGTTT
CTGGGCTCAATCCGAGAGCTGGATTTGTTTCTGTGATGAGCGAGTTGGTTGGAGATATTG
CCGAGAGAATTGTCTATAGGTAAAAAACATATTTGAAATTTGGAAAATAAATAGAACAAA
TTCTCGATACCGATTTTCCGGAAAATTTGAATTAATCGTATAAAAAATAATAGAATATTA
GCAAAAAATTCAATATTTTTCATGAAATTTTGAAAACTTAAATTTTCTTTCAAAAATTTT
CGATTTTTTAAAAATTGAAACAAATTTTGGAAAAAAAAACCTGAAAAACTTTTGAATTTT
TAAATTTTACACCTTTTTTTTCGAAAAATTATTTTTATTAAAAAACTTTTATTTTTCTAA
AAATTTTTTTTTGTTTCAGAAATTCCAAAACATCGTAATTTTTGAAAAATTTATCGTTTT
TCATGAAAATTCAACGAAATTGCGACAAAAATCCGAGAATTACAAACAATTTGAATTTAA
AAAAATGCAAAACAGCCTTAAGTTATGGGCGGAGCTTAATTTAGTGAAAATTAAAAAAAT
TTCATATTAGACTCCGCCCACATTTTGTTGGCTCCTTTCCAATAATCCATATCAATGCAC
AGAGCCGGAATGTATGCTCAAAACGACATTGCCGCATATCGTCCAGCTGCCGGAGACATT
GCATACCCGCAGATGCTCCAAATGATTCGAAAAATCGAAAATGAGCAGAAAGAGCAACAA
GAGAAAGAGCCCGAGGAGGGAAGTGCTCCGGCAACAGCAATTGATCAGCATTGTCTATGG
TATCCAACAGTACGCAGGACTGTTATGTGTCTTTCCAAGATTTTTCCGTGTTTGGATGTG
AGTTTATTAATTGAATTGCTACCCAAAAAATAATCGAAAAAATTGGTGAAGTTTGAGAGA
AAATTTGGCGAAAAATCAGGAAATTTGCCGGAATTTAAAAATTTTCGGCAAATCGGCAAA
TTGGCAATATATCATAATTTGAAATTTCCGGCAAATCGGGGATTGGGCAAATTGCCGGAA
TTTGAAATTTCCGGCAAATCGGCAATCGACAAAGTACCGATTTGCCGAATTTTCCAGAAA
AACTGCAAATTGCCGGTATTTATAATTTCCGGCGAATTGCCGATTTGCCGAGTTTGTTGG
AATTTAAAATTGCCGGCAATTCGGCAATTCGGCAAATTGGCAATATACCATAATTTGAAA
TTTCCGGCAAATCGGGGATTGGGCAAATTGCCGGAATTTGAAATTTCCGGCAAATCGGCA
ATCGACAAAGTACCGATTTGCCGAATTTTCCAGAAAAACTGCAAATTGCCGGTATTTATA
ATTTCCGGCGAATTGCCGATTTGCCGAGTTTGTTGGAATTTAAAATTGCCGGCAATTCGG
CAATTCGGCAAATTGGCAATATACCATAATTTGAAATTTCCGGCAAATCGGGGATTGGGC
AAATTGCCGGAATTTGAAATTTCCGGCAAATCGGCAAACCGGCAAATATCGATTTGCCAA
ATTTGCCGGGAAACGGCATTATGAAAAGTCCTTCTAAAAAATTCCGGAAAATCGGCAAAC
TGTAGGCATTAAAAATTTCCGGCAAACCGGCAATTTGCCAATTCCAGTTATAGTCCCAAA
TACACGATTTTGGCTCGAAAATTTCACCATTTATTAAATTCATTTTCAACGTAATTTATT
CATCCAATAATCGATCCAGCGAGCCCATCAATTATCGTATCACCAAGCTTTTTGAGTCCT
TTATCGATTGCGTGCTTTACCTTGTGCCAGAAATTTAGTTCAATTGGGCCATATCTTTGA
TCTTCTACAAGAGCAGAATCATTTTCCAGCTGCAAAGATCTCGCGATTGAATCCGGAATT
TGGATAACTTCGGAATTGATAGTGATTGAGTGATTACTTGGGGCCTGAAAAGCTTAGGGC
TAGAATTGGCCTGAAGTTTCAGATAATATAAGACTAATCTTGATAAAATTCAGTTTAAAG
TGTACGAAAAATCGCGTAAATTGGGTTATTTAGAGCTAGTTTCCAAGAACTGCCTGCCTG
CGGGCCTACCGCGTCACTCTTGTCGAAAATAGCCGTAGGTCGCCTTCATGGTGCAGCCCA
AAAGCGAAAAGTCGTGCTTACTTTCACGCAGGCGCAAAACGGCCTACCTCGTCTTAAATC
CAACCTACGACTACTCTGTCTTAACTCTTGGCAAAAGTAGGCATATGCCGCCTTCAAGGT
GCCGCCTGACATTTTGCAATGGCTAACAATGAACGAAAATGGTGTAGGCGTCTAATATAG
GCGTAGGTCGCCTTCACGACCCAAGCTGACACCTTCATACCTACCTGCGTGGGTGCTGAG
CAAGTTGGCTCAGCGACTAAGAGCAAGAGGGCTGCAAGTGGAACTAGAAGCTTCATAGTG
AAAACCTGAATGTTCCAGTCCCTCCATCAGCTTTTATAGTAGAGCTTATCACATAACAAC
AAAACATGTGGAAAGGGATGAAAACAAACTATTAAATTGGAACATCCTGCCCTTATCAAT
TGATGATGAGAGTTTTAATAGTTTTGAAACATTTTGAATCATAATCTTTTGTAGATGAAA
AATAAATAAATAAAAATACAGAGGCAACTAAACGCTTAATGTAAAAAATTCTGCAAACTT
ACGTTGTTAGCTATTTAACAGCGAATTAGAGCTATTCCTATACCTGCAAAACTGTTTGAA
AAATTGAAATGGCTTTACTTTCAGTGAGGAGTGGCATTACTTTGACCAATTTAAATATTG
TGGGATTGTTGGTAATTTCCCAAAGCTTTGTGGGATTATTTTGAAACATCCTAAACATTG
CCGAGTGTTTCATTTAGATATATAATATTTAAAATTTTTGATCCATATCGGGATGTCAAG
TATAATTTGGCCGAAACACCACCTGAGCTAGTGTAAAATTGTTATTTTTTTCTTCTCGAT
CCTTCTCCGGAAATACACTTAATACAGTTTAATGGTAGTTTCTAATAAGCTGGATTTTGA
TCCTTAAACCTTGTAAAATCGACAAAGAACAAATCTGTTTTGTATAATTATTTCTGCTCG
AGTGTTATTTTAATTTTTCTTTATTCAAATAATCAAACACGGATCAGACAAATGAAATAG
TTATATAAATTATTTCCCAATATGTCCATGCGCGTTTTTCAAGAAATCCAAGAACCCGTC
TCTCAGCTTCTTCCAGAAATTCAATTCGATTGGGCTCATTCTTAAATTCTCGTTTGCATT
TTCATTCAGTGAGAAAAGATCAGTGGAGTAGAATGGCGGGTTTTTCGACTGAAATTGGTC
GGGTATTTCACAGTAATAAAATGTCGGAAAATGGGATTTTCAACTTTTTTTTTAATATTA
AAAATTTCCACGAAGAAAACCCCAGTATTAAAAGTAAAGTAAGCGTGATATTGCTTTCAA
AAAATGCCCTTAAAAAATATCGGCAAGTCTGCCATCAATTTGCCGATTTTCTGAATATGC
CCAACTGCATTTACCTCCTCACCTGTACCTTACGGGGGTATTAAAGTGATTTTGGAAAAT
GTATTAAAATACATTTTTTTAGCTATTTGAATAAGGCAAAATGTGTATTTCAATACACTT
TTTCAATTTTCCGACACTACTTGAATAACCACAGTAGTACTTACAAAATGTCCTATCTCA
TTGATTTCATTGCCAATTGGTTTGTTGAACACTATTGGAAAAATGAAGAAGAATGACATT
AGAACTGTTGTAAAGTTCATCGCAAGAGTCTTCAAATGCTCGCTGAGCAGCTTGTGTTTT
ATACTGAAGTAAATTGGAAAAACATCCGCTGCGACAGTAGTGATCCTTATCATGCGGAAG
AGTTTGTTTTGAAACAAAGTTCAATGTCAACTTGCCAATATGTTTTTGTCTGTTTAATAT
TAAGATAAAATCGAAAGTTATCTACAGTAACCCAGTAAATCCTACAGTTTTGGTACAGTA
TATCATGCAGCGGTGGGCAGTAATTGCCGTTCGGCAAATCGGCAAATTGTCAGATTGTCG
ATTTGCCGATTTGCCGTTTTCCGGATATCAATTTGCCGGAAGTTTTTAGAGGGATTTTTT
ATAAGACGGAAACACTTAAAACTGTGCTTTTTTTGAAATTTTTTCCCGTTTTCTTTAGAT
ATTTTCATATAATTTGCTACTTTTTCAAAATAGATGTAGGAATTTTGCCGATTAAAATTG
AATTTCTGAAATTTCCAAAAAAAAAGTGCAAAACCACAATTTGCCGAAAAAATTTATTTT
AATAAAATCCTAGGAAGAATGCAGAAAGAATGCGCGAGAACATTTTACTGAAAGACGCAA
AAAAGTCGATCCAAAATAGTCCTAAATTCCGAAAAAAAAAAACACAAAAACGAAAAAATC
TGACTTTTAAAGGCGGTGTAGTCGAATTTTTTTTATTGCCTTATTAGACTCAAAATTGTC
GGAAAACACCGAATTTCATAATGAAACTTCTTGAAAACTTTTCAGAAAAAAGTTATGACG
GCTCAAAAAATGGCCTAAAATTAGTTAAAATTTGAAATTTGACCGACTTGTCTGGAAACT
AACTTTTTTGAAATCACCGCCAAATTTTGGGTATACTATCCAATTATCTTGCGTTTTTAA
CTCGATTTAGGTATTTTAAAGTCGATGGACGGCGAGATTTTTAATTTTTTTTTACCCAAA
ACTCGCCGTCCATCAACTTTTAAATAATTTAATCAAGTTTAAAACACAAGATAATCAACT
TGTATACTCAAAATTTGGCGGTGATTTCAAAAAAGTTAGTTTCCAGCCGCTTGACAAGTC
GCTCAAATTTCAAATTTTAACTAATTTTAGGCCATTTTTTGAGCCGTCATAACTTTTTTT
TGAGAAGTTTTCAAGATGTTTCATTATAAAATTCGATGTTTTCAGACTATTTTCAGTCTA
ATAAAGCAATAAAAATTCGATTACACCAGCTTTAACAAAAATTAATAAAAATATTGAATT
TTAGATTGGCGTATTCCACTCTCTGGCTCGTGACATGCTCTTCTCTTGCATAGACTCACT
CGAAACAGCATCCAAAGCAATCATGGAATCTCCAGCTCCTGCAAAAGGATGGAGCAAGAA
GCTCGATGCTCATCTATTCGTCGTCAAGCATTTGCTCATTCTACGTGAGCAAACTGCTCC
ATACCGTCAGAATGTGTTGAGGTGGTTGTGTGCTCTGAAATGAGAGCTTGTAGAAAAACC
GTTTAAACTAGTTTCAGGTCGGATTCTCTCAACACAAAGGACTTTTCCATCGACTTTTCC
AAGTTTACAAATGTTTTGTTTGATTCCAAATCGAAATGGTTCGAGTTGAGCACTGACAAT
GCGCTTTTGGAGCTCATCACTACAGTAATACTTTTTTATTAGACAAAAAATCTCCAAAAT
CGTCTGAAATTCACGAATATCACAAAAGAAACAGGAAAAAATCGAGAAATAATGAACAAT
TCAAGTTTTAAATTGGAAAATTTTTAATTTTGGCTAACGAGAACTGCAAGACCAATCAGC
GATTCGCTCCGCCCACTTTTCAACCAATCAGAGCGATTGGGCGGAGTTTAAAAACGCTGA
TTGATTGGAAAGGGCAATGTTTCTAAACAGGGCGAGAACCATTATTCCGGCAAACCGGCA
AATTTTTTTTCCCGGTAATTTTGCCGAAATTCAACTTTATCGAAAACTTTAGGCAAATAG
GCAAATTGCCATACATCAAAATTTCCGGCAAATCAGCAACTTGCCGTACATCTAAATTTC
CGGCAAATTGGCTTTTTGCCGGAACTGAAGTTTCCGGCAAATCGGCAGATTGCCGGAATT
GAAGTTTCCGGAAAATGGGCAAATTTTCGAAATTGAAAATTTTCCACAAATCGGCAAATT
TCCGCCAAATCGGCAAACCGGCAAATTTCCGGAATTGATGTTTCCGGCCAATTGAAAAAC
CGGCAAATTGCCGTACATCAATATTTCCGGCAAATCGACAAATTGCCGGAAATAAGAAAT
TTCCGGCTAATAGGCAAATTTTGCCGAAAATAAACATTTCCGGCAAACCGGCAATTTCCG
CCGATTTGCCGAGTTTGTCGACAAAAAAATTTGCCGAACAGACCCTGTTTCTCCTGTTCA
AAGGAAATTTAGCCAACATCGAGAAATTTAGTTTTTGAACGCTGTTTTCATCCTTTCGCA
ATTTTTTCTTTGCAAAAAGATTTTGATTTATAATCGAAAATTCCAAATTTTTCCAGGTTC
CAATAGAAATGCGTGAACAGGAGGGAGATTCACGTCGTGTTCTCGATCAACAGCTCCGAG
CCTCTACCTTTCGTCTTGCTCACGAAGCTTCACTGCTCATGATTCGAGATCTAGCTGATT
GGATTGAAATTGCCGAGGATGAGGTTGGCCTCTAAAATCACGTTTTTTTTTTCAAACTAA
ATACAACTTTTCAGCGTATGAAAGAAGGATTCCAGTTGTCAGGGCATCCGAAACTAGCCG
CCGGCGTGCTTAAAGATGTGTCTGCTGTGGCGTACAGAAATGTGGGCACCAAGTTTACGG
AGGTAAACATCTACAGTAACTCTACAGTACTCTACATCATTTGAACTGAAAACAGATGGT
TTTGTTCCAAACTACAGTAATCCTGTAGTTCTGGTACAGTATACCTACCTTACGACTAAT
AATCCCACAGTAACCCATTAATGTACCAACATCTCTATATGACATGGTGCATCGACCGGG
AACTTTTTCGCTTTGAATCTTTTTCTCAAGAGCTACAGTAATCCTAAAGTTCTGGTACAG
TATATTTGTACTGTACCGCTACAGTAATCCGTTAGTATCCTAACATCTCTATACTTGAAG
TTGAGATGAGTTGTATCTTCACAGACTACAAACTATGAACACATGGAATGAGCGAATTAT
ATGTAGTATACACTCAAAATAAGAAAACTGCGTGGCGTGTACTGCAGAAAACCTCATATT
TAGGCCCCGCCTTTTTCTCGTCCACTCACGGAGAAAAGGCAAAAATTTGGGGACCAACCA
ATATCAGGCCGCCGACATCCTACGGGTTCCGCGCGCCGCTATGTTTAACTCGCAGTGGGT
GTGGCGAGCTGTCTCCGCCCACTGCGAGTTAAACATAGCGGCGCGCGGAACCCGTAGGAT
GTCGGCGGCCTGATATTGGTTGGTCCCCAAATTTTTGCCTTTTCTCCGTGAGTGGACGAG
AAAAAGGCGGGGCCTAAATATGAGGTTTTCTGCAGTACACGCCACGCAGTTTTCTTATTT
TGAGTGTAATATATTTCACAATTTTTGAAAACTGGCAGAACAAAATCGAGTCCTTTATAA
ATATGAATGCATAGTATGCACTATTTGCCAACATTTTTATGAGATTTCATTTGAAGATTT
TCCTGACAAAAATCACGGAAATGAGAGACCAAAATAGTGGCATATCTGATAATGAGAAGG
TGTTTTCCTTCGCCCTGCTTTTCACAGGGAATGAATCAATGAACATGAAAATTGGATAAT
AGTAAATATAATGATTCAAGATACATGTTCAGTACAAGTATAATAATTGAAAATGAGATC
AAAAGCTTGATATTACACTAAGGGAGAAGTTCAGCCACGACTTTTTCTGCTCGAAATCCT
ATGAATGACATGTCCATCCTCTGCACACCGTAAAGAATCCGTGACTCGATTTGACTCCGT
TATCATGATGAACGACATGTCCTCCTCCATGATGATGCTGAGTGTGACCGTTGTAGTACT
GATGATATGGATTGTAGACTTGATTAGATAACACTTCGGGAGATGAGTGGAACATTTGGC
ATGAAGCCAAGGAAATTAGGAACGAAAGGAGGATGAGAAGATGGAATTTCATTTTTGGAG
GGTTTTTTTTTTGAAATGCTGGTTTGCCCGGGGAATTTAAATAGTTTAGCGTCGAATTAC
CAAGGAAATTGGGGGCGGAACCTCTTGGTTTTTTGATTTTCTGATTCTCTTGTCTCTCTC
TCTCTCATTGCAAAGATCCTTTGATCAAGAAGCGGGTGTATGCGTGATTGTAGTCGGCAT
TGCAATAGACAGGAAGCATCACTGTGACTGTGTCAACGTGACTGTGGTTATGCCAAAGAT
AACGGGAATTTGTATAGTTTCGAGGCGCTATTTCGGGGTACTGTAGATCAAATGTGGGCA
ACAATTTCCATTCGGTAATTTTTTGATCGACGAAAATTCGGCGATTTCCGGTTTGCCGAT
TTGCCAGAAATTTTCAATTCCGACGATTTGCCGGTTTGCCGGAAATTTTCAATTCCTGCA
ATCTGCCGGTTTGCCGATTTGCCAGAAATTTTCACAGGATTGCTCATTGAAATTGAGATT
TACAAAAAAAAATGTGCAAAACGAAAATTTGCTGAAAATTTTCGGCAACTGCCGTTTTTA
CCGCAAACCGGCAAACCGGCAAATCGCCGGAATTGAAAATTTCCGACAAATCAGCAAACC
GGCAAAGTGCCGAAAATGAAAATTTCCGGCAAATCGGCAAATTGCCGGAATTGAAAATTT
CCGGAAAATCGGTAAACCGGCAAAGTGCCGAAAATGAATATTTCCAGCAATTCGGAAAAC
TGGCAAATCGCCGGAATTGAAAAATTTTCGGCAACTGCCGTTTTTCCGGCAAACCGGCAA
ATTGCCGATTTGCCGGAAAAATCATTTGCCGCCACCCCTGGTACTAGCCACATGAAAATC
ATGCTTACAATTGGAGTTTCCAGAAATTTCTTAATACGAAAATGCCTGACATGGCTCCGT
TTTCCGGATTCCCAACTACTTTCATACTTCCTGAATTACACGTTTTGGCAAAAATTCCCG
CCTTTTTTGTAGATCAAACCGTGATGGGACAGCCTCACACCACGTGCGGATTCCAAACAA
ATTTCATATGAATTTCCTAATTTCAGATCCGTGCCGCGTACACCCTCTACATTGGCGTCC
CGGAAACCGAGGAAATTCTCCTGTCGCCTGTTCGAAAACGTGTCATTGACATCTTCACAC
GTGTCATCTCATTTGCCTCAAAAACCTACGATGCAGAATCCCTGGCGATTGCTGGTCTTC
CGAATGTGCAACAGCTCATCTTGCTGCTCAATAAGTGATTGAGCCGAGAACAATAATTTA
TTTTTTATCAATTTTTTATGTATCCTTTTTTAACCCCGGGTTTTTTCCGCTATGGCTTTG
GTTTTTTCTCCGTTTTCTCCGTTCGAAAATATGTGATTTTTATGGCTTGAACATGCTTGT
TTGTGATGATAAATGTAATCGTATGGGTGTTTGATTTTCGAACATGTTAGTGATCAACGA
TTTTCGCGGAAATCTTTTTTTTGTAGTGATAAAGATATCATCTTTTGGTTTTTCATGGGA
ATAAGAACCTTATAGGACTTTAATAGAATCATACAATATTATTCAAATGCAAAAAACTTT
CCGCCGGTATACGGTCTCGACACGACAATTTGTTTAATCAAATTTAAAAAAAAATCACGT
GGTGTCAGAGTGTCCCATTTCGGTTTGATCTACGTAGATCTGCAAAAAATGCAGGAGTTG
AGACGCAGGTTTTTTAACTAATTTTGCATGGTTAAGAACGTTCTGACGACACATGTTTTG
TGCAAAAAAATCCTGCAGTTTTTGTAGATCAAACCGTGATGGGACAGCCTTACACCACGT
GTAAATGCGAATAGGTATGCGCCTTTAAAGAGCACTGTAAATTTTAACTTCGCGTTTTTT
TTCGGAATCTGAGTAGATTTTCATAGTTTTCCGTCGAATTTTTCATTGTTTGAAATTTTT
CGAAAACTTTATTTTTGGAAAAACTAGAGAAACTAAATCGTGAAAACAATAAATGTCTAA
TAAAAAAACGGAAACGGGAGAAAATCGGGAGAAAAAAAAAATATTTTAGGCGCAAAATCG
CAATTTTTCGCGTCTAGATAATAATTTTCTCTGTATTCTTTGATAATTCTTTGATTTAAA
AATTTTAAGAAGAATTGATACTCGATACAAATAAAATTTTAAAAAATTAATTATAATTTA
AATAAAAAATTTCAAAAAAAAAGATATTACCCAGAGGTGGTATTTCATGATTTTACGTCA
AAATTACGGTACCAGGTCTCGACACGACAGAATTTTGTTGTATACAAAAATGCGCGCGCT
TTTCAAAAAAAATTGAAAAGTCGAACAACTAAAAAAATATTCCTCACCAACGATAGTTTG
ATATTACAGTACTCTTTAAAGGCGCACGCCTTTTTTCATTTAACAAACTTTTGTCGTGTC
GAGACCGGGTTTTCGCGACAAAATCTGAAAAATTTCGCGTCTGGATAATAATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1088, 1156..1322, 2349..2513, 3443..3676, 5165..5256, 5527..5670, 6100..6421, 7298..7458, 7982..8216, 12364..12560, 12611..12743, 13616..13762, 13814..13921, 16286..16692
1001..1088, 1156..1322, 2349..2513, 3443..3676, 5165..5256, 5527..5670, 6100..6421, 7298..7458, 7982..8216, 12364..12560, 12611..12743, 13616..13762, 13814..13921, 16286..16474
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved