Caenorhabditis_elegans Locus Y37E3.11
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y37E3.11
Caenorhabditis_elegans
Y37E3.11
I
Y37E3.20
7079..7197
8688
AAAAAAAATCATATAAAATCTAGAAAATTTTTTGAATTTTTTTATCGTGATATTCGGTC
ATTGTGACCCTATGGGCATGTTTTAAAGCAATTTCCCCACTAGGCTTACTGAGTAGAAAA
ATCCCGGAAGTGCAATTTTTGAATTTTTTGTGAGAAACTCCTCCACAATTCGTCATTGAA
AATGAAAAAACTCGACTAAATATTTTTTCCATGACAGGCGGTCTGCTCCGGGTTCGACGT
CCTTTTCGAACTGATAACGTCACAATTTTTTTCTTTTTTTTTCCGCATTTTTTCATTCCG
ATTGCTATTTAATCGGGTGATGTCGGGGTCACTCTTCAATGTCCGTTGACTACATTGTTT
TAATTTATTTTTAATTGACTCCAAATTTTCCCCTGATTTCGAATATCTATGTGAAAAAAT
TCAAAAAAATTTCCCTGATTTTATATTTAAGCTTGAAATCGCTTGTACTAGCATCACTTT
TTTTCAAATTCGCGCCCAAAGAAATTCGCATTGGAGCGCGCTTTGATTTTCTTCATTTAA
ATATTTTATTTATTTTTCGCCGAATGCAGTTTTTTGAAAACCAGTTTCATTCATTTTTGT
CGAGCTTTTATCGATTTTTTTCGACAAAAATGAATAAAACTGGTTTAAACTGAATTCGGC
GGAAAATAAATAAAATATTTAAATGAAGAAAATCAAAGCGCGCTCCAATGCGAATTTGTT
TGGGCGCGAATTTTAAAAAAAGTGATGCGGGGGACAAATGAAATTCTACGATTTCAAGCT
AAAATATAATATCAGGGAATTTTTTTTGAATTTTTTCACATAGATATTCGGAATTAGGGG
AAAATTTGGAGTAATATAAAAAATATTTCACAGATTTCGGTACTCAACCTTTAAAATTTT
AAGTGAGAAAATATTATTAACGTGATTTTAAATTTTTTTTTCTTCTGCAACAATTTGAAC
TTTGATCTTAAATTAAAAAAAAAAATTATTTTTAAAATTTCAGTTCAAAAATGAGCGGAT
TAGCACCAGATGGACTGCCCAAAGGAAATCGAGTTTGGGCTGATGGATGGTTGGTTTTTG
GCTGGAATCGACACGTGGTGTCAAAGTGTCTCTTTTCGGTTTGATCTACAAAAAATGTGG
GATTTTTTTTCCAAAAAAATGTGACGTCAGCACGTTCTTAACCAATTTTTGTTGAAAAGT
CTGCGTCTCTTTTCCCGCATTTTTTGTAGATCTCTACGTAGATCACGCCGAAATGAGACA
CTTTGACACCATGTGAATTGAGCCTTAAAATGAATTAATTTTCCAGTTATGACATGGTGC
ATTTCGGCCATGCAAATCAATTACGGCAGGCTAAGCAGTTTGGACAGAAGTTAATTGTTG
GAGTACATAATGATGAAGAGGTTTTCAATATTTTTTTCTCCCTAAAAAGAAGATGGGAAT
ATGCAAATTTTTGTTAAAATATTAGCAGTTTTTAAGTCGTAACTCGTAAATTGCGAAATT
TTTCCCTATAACACACTTGATCTACGCTGATCTACAAAAAATGCGGCAGAGTTCTTAACT
CATTTCGTATGGTTAAGAACGTGCTGACGTCACATTTTAATGGGAGAAAAATTCCCGCAT
TTTTTGTAGATCAAACCGTAATGGGACAGGGACCCCTGGCACCACGTGGCTATAAATTAT
TTTAAAAATCAACTTCTGTGAATTATTTAAATTAATTTTCACTTTAAATTACGATAGTTC
AGGTAAAAAATATTGTTTAAATAATTCAATTATTCAATTTTCCTTATTAAAAGCCACGAA
TTAAAAAGAAATTTCGTGACTTGACAAAAATTTTAAAGGAACACGCGTGTGTGACCCTTT
AAGGAGTACTGTACTTTTAGCTATTTTGCAGTTTTTTTTCATTTTTTTCGAGATCGCGTC
GAGACCCGAAATAGTTGGCATCTGGTAAATATTCTGATTGAATGGATATTTTCGTTATAA
TTTGGGGTTGCATGGAAAAAAAAAGAATATTTTACAATATTTTTCACTAAATATATCGTA
AGTTAGGGTATATTGTGGTAATCATTAAAAATTTTTAAATTTCAGATCGAAATTTAGCAA
AAAAAAAACATTTTTAGTGACTAAAAAAACATATTCGTTTCTAATTTCCAATTGAAATAG
AAAAAAAAACGTTAAGTAATATTTTTTTTTATTGCAATTTTTTCCGACCTTTAAAGGTGG
AGTACCGAAATCTGGGAAATATTTTTAATTGACCCCAAATTTTCCCCTAATTCCGAATAT
CGATGTGAAAAAAATTAAAATTCAAAAAAAATTCCCACGATTTTATATTTAAGCTTGAAA
TCGCCGAATTTCATTTGTTTTTCCCGAATCACTTTTTTCAAATGCGCGCCCAAAGAAATT
CGCATTGGAGCGCGCTTTGATTTTCTTAATTTAAATAAATATTTTATTTATTTTTCGCCG
AATTCAGTTTTTTAAAACCAGTTTCATTAATTTTTGTCGAAAAAACCGATAAAAACTCGA
CAAAAATGAATAAAACTGGTTTTTAATAAAACTGAATTCGGCGAAAAATAAATGAAATAT
TTAAATGAAGAAAATCAAAGCGCGCTCCAATGCGAAGTTCTTTGGGCGCGAATTTAAAAA
GTGATTCGGGGGCACAAATGAAATTCGGCGATTTCAAGCTTAAATATAAAATCACGGAAT
TTTTTTTTTGAATTTTTGGAATTTTTTCACATCGATATTCGGAATCAGGGGAAAATTTGT
AGTTTAACTCAAAAAAAAAATTCCAGATTCGACTACATAAAGGACCTCCAGTATTCAATG
AACAAGAGCGATATCGAATGGTTGCCGGCATTAAATGGGTCGATGAAGTTGTGGAAAATG
CGCCATACGCCACAACAGTCGAAACTCTGGACAAGTATGATTGTGATTTTTGTGTTCACG
GAGGTAAAAATATTAATTAAAGTCCAATCACGGTTTGATCTACAAAAAAATCCGGGAATT
TTTCGCCCAAAAGCAATGTGACGTCAGCACACGCTCTTAACCATGCGAAATCAGTTGAAA
ACTCTGCCGCATTTTTTGTAGATCAACCAGAAGATCAAGCCGAAATGAGACACTCTGACA
GCACCACGTGTAAAAAAAGTAGATCAATTTTCCAGACGACATAACTCTAACCGCCGACGG
AAAAGACACGTATCAAGAGGTGAAGGATCACCAACGATACAGAGAATGTAAGCGAACGTG
TGGTGTCTCTACAACTGATTTAGTTGGCCGAATGCTTCTGCTCACCAAGAACCATCACAC
ACAGGATGAGCACATCGAGCAACACGTCGAACGAGCTCGTTCGCTGAGCACGGTAAGTCG
GAATTATTGGAAGACTTGTGCCACTGGCTGGGGGGAAATTGCTTTAAAACATGGTTTAAA
AAATTCGAAAAAAAATTTTCTAAATTTATTGGATTTTTTGAAAATTGGAAAAATCTCAGT
TTTCACATGATTTCTATTTATTTGAATTTCCGCCAAAATTATGTGTTCGATGGAGCGCGC
TTGCATTGTTTTTACTAATATATTTCATTTTTTCTCAGTATTTCACTGATTTTCTTGTAT
TTTCATCGGAAAAAAAAGAGAAAAATGAAAGATGAATGCAAGTTGTTCATTAAAAAAAAG
TTATTGAAAATGGGTTTTACCACAGTGTTTCCCATTTTCAATAATTTTTTAATAAACAAT
TTGCATTTATCTTTCATTTTTTTCTCACTTTTTCCGATAAAAATACAAGAAAATCAGTGA
AATAATGAGAAAAAATGAAATAAATTAATAAAAATAATGCAAGTGCGCTCCATCGAACAC
ATCATTTCGGCGGAAATTCAAATAGGAATTAGGGGGAAAACTGAGATTTTTTCAATTTTC
AAATTTTTTTGAATTTTTTAAAATCATGTTTTAAAGCAATTTCCCAACTGGCGCTACTAC
GATTTTCAATTAATTTTTAAAAATTTTTAAAATTTTAGGCTATTCTGGAGTACAGCAAGG
TAAGCGTAGCCGGCTGCTTGTCGTTTTTTCCAGTTTTGCAAAGCTTAATTTTTCAGCGTA
TGCAGTCTAAAAAACGGCGTCTGAATAGGCTTATAGCGGTAATGGACCAAATTTTGAATT
TTAGTGGGCCGCACGGATTTCTGGCTTCCCTCATAAATTGAAATGGAAGAGTTTTTGCCG
AACTAGGCCATGTGGATTTACGGCGCGTTGCGTGTCGCGTCGCGGTTCGATTTTAGTTGT
AAAACTAAATGTATTTGTCCGTGTGGAGTACACCACTTTCCCAAGGCGATTGTCAATGGA
GCGCGAAAAATTCAATGAGGAAGCCCGGAACCCTATGGGGCTTAAAATATTATTTTTTTT
TCAGAACAAGCTTAGAATCTACTTTTTCTATTACGTGTTTATCCAGAGATGAGAAAAATG
GCCATATCTGCCGCGCAAATGAATCTGCGGGAAGAGACAAAACTACTGTAGTTTTTAACC
AATTTGTGTAGATTTACGAGCTATTGCGTCATCGTTGAATTTAATTTTGAGCCGCAATTT
TTAATTTTCAGGCGTTTTTCTAAATTTTTTTGTGTGTTTTCTTTTAAGATTTTTCAATAA
ATAGATAAATTTCAATATAAAAACGTGTGAAACGCCTGAAAATTAAAAATTGCGGCTCAA
AATTAAATTCAACGATGACGCAATAGCTCATAAATCTACACAAATTGGTTGAAAACTACA
GTAGTTTTGTCTCTTCCCGCGGGTTCATTTGCGCGTCAGATATGGCGATTTTTCTCATCT
CTGGATAAACACGTAATAAGTACAATTTAGTGTAAATTTTCTAAATTTCTTTTCAGGACA
ACGTTGCAATGTCCCCCTGGACACGTGTCTCGCGCTTCATCCCAACAACGACAACGATTC
TCGAGTTTGCCGAAGGAAGACCGCCAAAACCGACGGACAAGGTTGTCTACGTGACCGGAT
CGTTTGATTTGTTCCATATTGGACATCTGGCGTTCCTGGAAAAAGCCAAAGAGTTTGGAG
ATTACCTGATTGTGGGAATTTTATCGGATCAGGTAGAGCGTTTTTGTTTAGAAAATTTCT
GGGAAATAATTTTAATTGACTCCCCAATTTTCCCCTGATTCCGGAAAAAATTCAAAAAAA
ATCCCTGATTCAATCCCTTTAAGCTTGAAATTGCCGAATTTCATTTGTGCGCGCTAAAAA
AATTCGCATTGGAGCGCGCTTGCATCGTTTGATTTTTTTTTTCGCCGAATTCAATTTTTT
AAAACCAGTTTCATTCATTTTTGTCTAAATTTTATCTGTTTTTTTCGACAAAAATTAATG
AAGCTGGTTTTAGAAAACTGAATTCGGCGAAAATAAATAAAAATTTAAATGAAGAAAATC
AAACGATGCAAGCGTGCTCCAATGCGAATTTGTTCTTTTTTTGAAACAAAAAGTTTGATT
TTAAAATTTAAATAAAAAAATGTGATCTACCCAAATTTTAAAAGTTTCTTTTTGTGATTT
CCATGAGAAAAGGCGTTAAAAATATCAATTTTTCGTGAAAAGGGTTAATTGATGTGCCAT
CCTCTCAAAAACTTCACAAAAATTCAAATTCTTCAATTTTTTATTTTTTATCTCAGCCAT
CAAATTTGCGATGGAGCGCATTTGCAAGGTGCTTTTTTTTATTTAAAAATTTCTATGCCG
AAAAATGAAGTTAAAATAGCGATTAACCCGTTTTCACCTCAAAAATGCATTTGTGATCTA
CCACACCTGGCGGTAATTTCGTAAATTTCTCTGTAAATTTCTTTTAAAAGTGGAGTAGCG
AAATATGTGGAAATATTTTTAATTTACTCCAAATTTTCCCCTGATTCCGGAAAAAATTCG
AAAAAAATTTCCCTGATTTTATATTTAAGCTTGAAATCGGCGAATTTCATTTGTGCCCCC
GCATCACTTTTTTGAAATTCGCGCCCAAAAAATTCGCATTGGAGCGCACTTGCATCGTTT
GATTTTCGCCGAATTCAATTTTTTAAACCTGCTTCAATAATTTTTGTCGAAAAAACCGAT
AAAAAATCGACAAAAATTAATGAAACTGGTTAAAAAACTTGAATTCGGCGAAAATAAATG
AAGAAAATGAAAAAAAAAAACGGTACAAGCGCGCTCCAATGCGAGTTTCTTTGGGCGCGC
ATTCAAAAAAGTGATGCGGGGGCACAAATGAAATTTGGCGATTTCAAGCTTAAATATAAA
ATCAGGGGAAATTTTTTTGATTAGATATTCGGAATCAGGGGAAAATTTGGAGTCGATTAA
AAATATTTCCCAACTTTCGGCATTTTTACATTAAAAAAATGAGAAATCTACCACAATCGA
ATAAAACTATCAATTTCACAGACTGTCAATCAATACAAGGGAAGCAATCACCCCATAATG
TCGATTCACGAGCGTGTACTATCCGTTCTGGCCTATAAGGTTTGTAGTTTGAACTTTTCG
AAATAAATTGAAAAAATTGAAAATTAAAAAATTTTTTTCAGCCAGTGAATGAAGTTGTGT
TCGGTGCTCCATATGAGATTACTTCTGACATTTTGGATCAGTTTAATGTTCAGGTAAATG
CTGTAAATGTTCGAGAAATTTGAATTTGAATTTAAATAAACAAAAAATTCAAATTCAAAT
TCATGTTTTAATAAATAAATTAATTCTCCATACATGATAATCCAATTTTTTCATCCAAAA
TTAATGTAGAAATGAAGAAAAAAGCTTGTTCTATCTGAAAATTATATTTATTTCTGTTGA
AAAGCTTGAAACAGGCCTTTGAGGCGTTTTTGAAGCATTTCCACAGAAATAAATAGTATT
TTCAGATAGAACAAGCCTTTTTCTACTTGCCTACATTAATTTTGGATGAAAAATTGGATT
ATCATGTAGGAAATAAGACGTTTTGTGCGTTTACAGTCCGTGTTGAAAAGTTATCAAACG
CGCGCGCGCGAGAGAGTGTGCGAAACGAGGAGAGTCGCACGCAATAGATAGAGGCACGCG
AAACCCGCGAGGTGTCGGCCGGCGCGTAAAAGTACCCAACAGTGCCGACCAGCGCTCCTC
AAGCCTCCTGGCGCTGCTATTAGCCGGGATTCATAGGCTGGCGATGATTGAGATTGTTCC
CACACGCAATTTCTCCTGATCCACATGAAGGCTAAACTTCCTTGGACGTCTGAGCCGCCT
TTAATAATGATTATTAATGATTAATTTTGAGAATTAAGGGAAATTATTGGATTTTCCATT
TTCTCCTGGAAATATCAAGGTTTAAACTTTCAGGCAGTTATCAACGGATTCCGTGACAAC
AACTCCTCAGTCGTCAACTCATCGCTTGCATCGATCGACCCGTTCGCAGAAGCCAAACGT
CGTGGAATCTACCATGAAGTGGACTCGGGAAGTGATATGACCACCGATTTGATTATCGAT
CGAATCATCCATCACCGTCTCGAGTATGAGACACGAAATAAGAAGAAGGAGAAGAAAGAA
GCTGATGTGGCAAAAGCCATGAACTTGATTTAAATATTTCTTTATTTTTTTAAGCATTTA
ATGCCTATTAATGCCTATTAATCAATGCTTTTCAATTCAATTCTAGTCGACCTAATATTT
CCATTTTTTTTCTCTCCCACTTGCCACTTACACTTTAATTCCTTTATTTAAATATATCAT
CAGTTTTTCTTTTATTGTACATAAATTATATAATATCACAAATGGGTTAGCTCAAACGAA
ACACAGCTCGGCTCGTCGAATCGGGCCAGCGGAGCACGAGGTATCGACCGATTTGAAGAT
CCCGATTCGTTAGAAAGGCGGCAGAGGCTTTCGTGACGGATTTTTGGGAGCATTGGGCCT
GGAAAAAGGTTTTTGGATTTTAAAAAATTTGACGAAACTCTTTTTGGTGGCAAATTTAAA
ACAACAGTCGAGATATTACGGGAGCACTAAACTCTGAGAATGCGTATTACACAACATATT
TGACGCGCAAAAAATACAAATATCTCGTAGCGAAAACTACAGTAATTCTTTAAATGACTA
CTGTAGTGTCGATTTACGGGTATACTAGATTTTCGAAATGTTTTAGAATTTACTTTCGAA
CATTGACAACATTTTTGTATTCTTTTTCTAATATTTTGGCGATTAATAAACGATTTCCGT
AAATCGACACAAGCGCTACAGTAGTTATTTAAAGAATTACTGTAGTTTTCGCTACGAGAT
ATTTTGTGCGTCAAATGTTATGTTGCGCAATACGCATTCTCCCAATTTTTTGTTCCCGCA
ATAAAGTTTTTTTTTAAATATTTTGTTTAAAAAAATGATTTAAAACATTTTGTAAATATG
GATTTTTGAATCTATATATCAATTTTTCAAATATTGCCGGGCATTCTTTCAAACAAATAT
TCGAAAAATTCAATTTTCCAGAAAAAAATTGGCAGTTGCCGAAAGTTGTAAAATTGTTTT
TTGCACGGGCTTCTGGCCTTCCTCATTGAATTTTTCGCGCTCCATTGACAATTGCCTGCC
AGACGGGAAAGTCGTGTGCTCCACACGGACAATTACATTGAGTTTTACACTTAAAATCGA
GCCGCGACGCGACACGCAACGCGCCGTAAGTCTACTGAGTCAAAATGGCCTAGTTCGGTA
AACTCTTCCATTTCAATTTATGAGGGATGCCAGAAACCGCGAGTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1306..1399, 2786..2942, 3155..3351, 4856..5071, 6381..6458, 6521..6592, 7293..7688
1010..1068, 1306..1399, 2786..2942, 3155..3351, 4856..5071, 6381..6458, 6521..6592, 7293..7529
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved