Caenorhabditis_elegans Locus Y37E3.8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y37E3.8
Caenorhabditis_elegans
Y37E3.8
I
Y37E3.21, Y37E3.22
1216..1354, 1587..1726
2932
TTACTTCCAGTGATGGTGGTGACGGCTCTCGGCGTTGACCGGATATCAAAAATGATTGG
TTTTTGTACCCATGGAATTAAGAAATGAGTTCCTTCTCCGACGACCTCGTTTTTCACTCC
ACTGAATCGGTCGAAGATGACTGCTCGTTGACCTCCATCAACATTGTAAAGAGCAGTTTG
TGCGATTCCTCCAGCGATGGAAAGGCCCACTCCGACAGTTCCCAAGCGACCCAAAAGCTT
CTGTGCAGATGCAGCCATTCTGGTAAATGGAAGTTAATAACTTGGACAAAAAATGGGAAA
TAGAAAGAGAAATGAACGAGCTATGATGCAAAATTGATAATAATCCTAATTATCACGAAA
TTAGATGGATGAATTAAATGGTGTCAGGAAATCTAAATTGAAAAAGTGAGTTTAGTCGAG
TAAAATTAGAAAACAAAAAATACTTCAAAAATAATTACGGAATGTTATAAATAATGCAAC
ACAAAGTATTTTTCGACTTTCTCCACGAATAAATCGATAATAACAGTGAGCCTGAATCAA
AAAGTACAAAATATCAATAACTTATTTATTTGCAAAATTATTTAATTAAATTTTAACTAA
CTTTTCTGCTTTTTTAGCTTAAAAAATCGATTTAAATGATGAAATAAGTTGCGCAAAAAA
TAAAAGAGTTTAAAGGGAGGCTGCATTTCATCGAGAGGGTCTCGCCACGAAATGCGCATC
AAACGAGTGTGACCGTACCTCAGATTTTGGGAGACACACTCACTGAATTTTTGCGAATAT
TTTAGGATTTCTTTTTGTTCTCAATGGTTTTTCGCTAGGTTTTAATGAAAAAAGTGTGTG
ATCTGGTCGATTTTAATTATCTTTAAAGACAAAATTTGTATTTTTGTAGTAATTTTATCC
GAGAATATCGGGAACCTTTCATTGAATATTTTTCTCTGATTTTTCTTCTCCATTTTCGAT
CGAAATTTGCCGCTTTTACACATTCAAATTGTTTACTTTACAGGGTATGGCTCACGCGTT
GAGAAAGACAAGAAAGCTCCGTGGTCACGTCTCGCACGGACACGGACGTATTGGAAAGCA
CAGGAAGCATCCTGGAGGTCGCGGTAACGCCGGAGGTCAACATCACCACCGTATCAACCG
TGACAAGTACCATCCTGGATACTTCGGAAAGGTATTATTTTTAAGGTACTTTTTTAAAAG
TTCGTTGGAAATTATCCGCTCCTATCTTGGCGCTTCCATTGGTGAATATGGCTGTGTATG
TTATAGGAGAGATAGTAGTGCCTTTTGGCTTTCGGATCTCCTTCGGTGTTTGTCTTGCAT
CTCGACAAATGTCATCCTCTGGGTTCGAGACAATTAAATCTAATATGTTCTTTATTATCT
GACACTCAAACTTTAATTTTCAGGTTGGAATGAGAGTGTTCCATCTCAACAAGAACCAAC
ACTACTGCCCAACCGTCAACGTCGAGCGTTTGTGGTCTCTTGTCCCACAGGAGGTTCGCG
ACAAGGCCACCGGAGGCAAATCCCCAGTCATTGACTGCACCAAGCTTGGATACTTCAAGG
TGTGTTTTGAAACAAGTCAAACAAGAATTTCTCTCGTCTTGGCGCTTCCACTGGTGAATG
TGGTTGTGTATGTTACGAGAGACAAAGTAGCGCCTAACGGCTTTCGGATCTCCTTCGGTG
TTTGTCTTGAATTTCGACAAATGTCATCCTCTGGGTTCGAGACAATTATCTTTCATGACT
ATGAAACGTAAATTTAACTGTTCTTATTTTCAGGTTCTCGGAAAAGGACTCCTCCCAGAG
ACTCCACTCATCGTTAAAGCCAGATTCTTCTCCCACGAGGCTGAGCAAAAGATCAAGAAG
GCCGGAGGAGCTTGTGTTTTGGTGGCTTAAGCCATGTTGTTACCTTGTATTAAAACAATG
TTTCAAGTTGAATTTGTTCTTGTTGTTGAATTCTATTCACATGGTCTTTACCCATGCTTC
ATATCTTATTGTTTTCTTACCCTGGTCACTTTGTGGCATTAATACTTTCTTTCAGCGTTC
TATCAAACGTTTGTTCTCTTTGGAGCTAAGGCAAACCGCGCAACTTACGATTGAAGAATG
GCTTCGAACCAAGAACTGGCTTGCGTCTACGCTGCTCTCATCCTTCAAGATGACGAGGTC
GCCATCACCGGCGAGAAGATCGCTACCCTTCTCAAGGCCGCCAACGTCGAGTTCGAGCCA
TACTGGCCAGGACTCTTCGCCAAGGCTCTCGAGGGAGTTGATGTGAAGGTAAGGATTTCT
CATAAGTATATTCAAGTTTCACCCCGATTGTTTTCAGAACCTCATCACTTCTGTCTCTTC
CGGAGCCGGATCTGGACCAGCTCCAGCCGCCGCCGCTGCTGCTCCAGCTGCTGGAGGAGC
CGCCCCAGCTGCCGAGACCAAGAAGAAGGAGGAGCCAAAGGAGGAATCCGATGACGACAT
GGGCTTCGGTCTCTTCGACTAAAGATCTTGTTATTTGTTTTCAATAAATCTGTTAACAAC
ACCAAGAAAGTGTTTATGGCTTCAAAAGTGAAAAAAGGAGGTTATTTTGGCACTACTCGA
TTGTTCAGAACGTTTTGAATCCTTTGTATCCGGCTATATTGTCGACCAGGCGCTTTTGGT
GGCAAGAAATAGTTGTCTTTCAGAATGATAGTTGGCTCTTCTTTAACACTGTTAGATTCC
GGCGAAACAGGCTTCGTGCTTGTTTGTGAGATTCTGCAAAAACTGAAACAATCGGATTTC
TCAAGTAAATTAATGTGACTCACTTTACAGGATCTCGTGGAGTTCCTGTTTCAGGCGTGC
TCTGAATGATATCTGATGGTATTGTCGAGCTGGCAAGCGACATCGGCGGACTTTCTTCAA
TATGAACCGACGCGGACTTCGGATCCGATGGAGGATCAGGCGGGATCGGTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1170, 1403..1558, 1773..1932
1006..1170, 1403..1558, 1773..1886
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved