Caenorhabditis_elegans Locus rpl-7
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rpl-7
Caenorhabditis_elegans
rpl-7
I
F53G12.12
1257..1390
3382
AGAGCCCATCTTTACTGCTGAGCTGTAAAATGATAAAGCTTGTTTGAAAGTTGTGTATA
TATTGGGACGATTGTAAAAAAGAAAAAGGGCATTGGTCACATGATTCATCAGCCGGGCGC
AATGTTTTGTTGTAAAATCGATATTAAAAGAACGAGACACTGTTTTATCGGCGGAGAATA
TTTTTATGTTCTGTTCCCGACACAAACGCGGAGTCAGGAACCGGTTGTCTATCTCGACGG
GGATTGAAAAAATATAAGTGAACTTGATTTAAGAATGATTCAAAGTATATGGAGTTGGGA
GTTTTATATTGAATTTTATCAATATATGAGGGTGGTTAGTCAGAAGAAAAATGTGAAAAT
GTATATAGAAGTGTGTTATGAAAGAGTATTTGAGGCTTATCATACCCGAAAAAGGGAAGG
TGAGCGGCCGAACTTTGTTTGTCGACACGATTTCGAAATAGTTGAACAGGATATTTTTAA
CAAGGGAAAGCTTTCTCTGGGTGTTCTTTTTTGATAATTTCAGCTAAAAATTGAAAAAAA
TAATTAGTTTTATGGCTGTGAACATCCAGAATAAGCTTTTCCGAACGCGAAATGCGTGTG
AAACCCATAAAATCGAACGTAAAACAGGTCAGGCGCACCGGCGCAGCCACGTCGGTCTGA
GGGTACGCGACGCTAGCCGCAGCGCAAGCCTCCTCGGGTCTCGGCACGACAACTACCGTA
CCCCTTTCGCAGCGGCGCAACGGAATCTCAATTTTACATTTTTTTCTTTTTGGCCTAACG
AATTTTTCCGTTTTTTCAGAGCATTTTTCATTGATTTTCTTAAATTTTCATCAGAATAAA
TTTTAGAACTAATTTCCCGTAATTCTGATACGCGTTTTTTATAGTTTTCGTGAAGAAAAT
GCTGAACATTCGAAAAATACTGAAATAATTTAGTTTTGAAAACTTGCTCCTCTGTTTCAA
TATCTTATAATTTTCTTTTCTGATTAATATTTTGATTTTCCAGGTAATCAATCGCCTATA
ATGGCTCCAACGTAAGTTTTCTTTATAAATTTATATTAGATTGAAATTTACTTTTAGGCC
TGACTTTCAAATACTTCAATTTTGATATTAATTCTTGGTTTTTCAGAAAGAAAGTGCCAC
AGGTTCCAGAAACTGTGCTCAAGCGCAGAAAGCAGAGAGCCGATGCCCGCACCAAGGCTG
CTCAACACAAGGTGACCGTCGCCGCTGTAAGTTTATTTAACTGTCAGAAAACAGAAAATG
CTCTTCAAAAGCACTGGTTTTAGGATCCACTATTATCCAAGCCAGCCGTCAAAACTGAGC
TATAAGAATTATCTTGTTTTTGGGTGAGGTGTATTCAATTCAGAATGCGTCTCAATAACA
CGATGACAATTCGAAATTTTAAAGTTTAAATTTTCTTTTAGGTGTTTGAAAATTAATTTG
AACTAATCCTGCATTAAAAATAAAATTTTTTACAGAAGAACAAGGAGAAGAAGACCCAAT
ACTTCAAGCGTGCTGAGAAATACGTCCAGGAGTACAGAAACGCCCAAAAGGAAGGACTCA
GACTCAAGCGCGAGGCTGAGGCCAAGGGAGACTTCTACGTTCCAGCTGAGCACAAGGTCG
CCTTCGTCGTCAGAATTCGCGGTATCAACCAGCTTCATCCAAAGCCAAGAAAGGTGAAAT
TGTGTTAATGAGTTTTTTAATAACCATTCTTTGTTTTCAGGCTCTCCAGATCCTCCGTCT
TCGTCAGATCAACAACGGAGTGTTCGTCAAGCTGAACAAGGCTACTCTTCCACTTCTCCG
TATCATCGAGCCATACGTAGCTTGGGGTTATCCAAACAACAAGACCATCCACGATCTCCT
CTACAAGCGCGGATACGCCAAGGTTGACGGAAACCGTGTCCCAATCACCGACAACACCAT
CGTCGAGCAGAGCCTCGGTAATTTGAAAACTTATGCTTTTTAATTCTTATTTAATTGTTT
TCAGGAAAGTTCAACATCATCTGTCTTGAGGATTTGGCCCACGAGATCGCCACCGTCGGA
CCACACTTCAAGGAGGCCACCAACTTCTTGTGGCCCTTCAAGCTCAACAACCCAACTGGA
GGATGGACCAAGAAGACCAACCACTTCGTTGAAGGAGGAGACTTCGGAAACAGAGAAGAT
CAAATCAACAACCTTCTCCGAAAAATGGTCTAACTTGTTTGTTGTTCATACCTTCCTTCC
GGATAAATCGTTATTGTTTGACGTTGTTTAATTATGTGCATAAATAATCATGAAACGTGA
TCGTCTTGGCTCGACTCATCTCGCATTTCATGAAGCGTCTCATCATTCAGATGAATCGTA
AAACCGCTTTGCTGACTACTCTCCCGAGAACAGTCACTGTTCCCTACTATGCTCCATCCT
GTTTATTTCTAGAAACTTTTCTTCGGAGCAAGCTAATTCCCTATGAAGTGAGAGCATTTA
GGTTAATAAACATAGTCCAGATTTAAATCCAGACAACGCAATGTTCTCTCTACAATGTAC
TCCCTCGTGAGCACCTATACCCATTGATTGATGTCGATGGGTATTTCTTCAAAAATTTGA
TGGAAGGACTTGATTATCTGCTCGCCAAATATGGAAAAGTTGGCTTAAAACTAGAATTTT
AGAAAAAGCTTAAATATTCTTCCAGTCTCTGGACTCGGGCCTGACTCCAAAAGAGCGAGC
ACAGGCTCTCGCATTGAGCGCTTTGCTCGACGAGCTTACTTGGATGCTCGCCTACTCGCG
AGGCCAAGATTTCACGTGGCTCCGCGATGATCGTAAGATTATCGAAGACTTCGGGCTTGT
TCAGCTCTATTTTTGGAGGAATTGGATTGTACCGCAGATGCAGAAACGGGTAGATTATTG
ATATTTTATGGAAAAATCGATAAAATATTGATTTTTTACTGAAAAAATTGATCAAAAATC
GATTTTTTTTTCCTCGGAAAATCTGTAAATTAGTAGTTTTTTGTTGAAACAATCGATAAA
ATTCTGGTTTTTCAGAAGCAAAATCGATATATTAGGCCAAAATCACCAAAAATTATCAAT
TTTCCTATAAAATTTACCATTTTTGGCTAGATTATCGATTTTTAAGGCAAGAAAGTCGAT
ATTTCACAATTTTTTATTGATTTTTTTGGCTTTCCAGCGCGCAAACTGTGCCAAGATCTA
AATTTTCCGAAATTTTCATTTCAGACACGCCGCCGAGTGCGAGGCTACGGAATATCCGGA
AAATCGGCGAGAAAGGAGGTCGCCTGCCGAACTGAAGCAATGTTGGAGGCATTGGCCTCA
CTTTTGGCCTCGAATAAATACTTTTTCGATGTCAATGAACCGTCTTGGGTAGGTGGCAGC
CAAAAAACTCGGCCAAAACTCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1126..1225, 1475..1672, 1720..1936, 1984..2232, 2377..2382
1020..1030, 1126..1225, 1475..1672, 1720..1936, 1984..2189
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved