Caenorhabditis_elegans Locus Mono:27:C07A9.14
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:27:C07A9.14
Caenorhabditis_elegans
Mono:27:C07A9.14
III
C07A9.14
1001..1079
2079
ATCCAAATCCCATCAAAAGATCTAAAAATTATTTTGTGAAAGGCGATTTTTGGGTCAAA
AATACGGTACCCGGTCTCGACACGACACCTTAGAAGAGTGATGTAATTTCAAACTCTGTG
GATTTTTAAGTTATTTTTCATAGTTTTTCGATTAAAATATTTTTTAACTAAAAAAAATCA
ATGAAAACACATGAATTCGTGAGAAAAACTATAAAAAATCGATTAAAATTCTGCAATAAC
AAAAGTTTGAGACTACAGTACTCCCTCTTTAAAGGGGCACACCTCTTCCCCGTTTAACTC
AAATCTGTCGTGTCGAGACAGGATACCGTATTTTCGGGGTGAAGCGCGCAAAATTTACAG
TATTTAACTTACTAAATAAAGGACCTCCAATAGCTGCAGCCATAGCCATTCTCGGATAAC
CTTGTTTAACAACTGAAACATCAGCAATCAAGTCTCCAATACTATTACTCCATGCAAGAA
TTGTTAGACCAAGTACTTCATGTGATACTCTTGAAACAACTCCAAGCATTGTTACAACAT
TTACAACTTCCGAAGAAATTAAATAAATCCATGCAATTGACATAATGAATCCAGAATATG
AGTAGATTTCCTGGAAAAAAGATTGAATTTCCATTTAAACGAATTTCATACTCACTTTAT
AGTATTTCGGTTGAACACTCAATTCAGTAAAAACCATAATAAGAATAGCAAGTACAATTG
AAACTGCCAAACCGTATACCCAGAGACCAGGACTTCCAGAAAATGGAGTTTCGAGGAAAA
CTAAAATTTTTAAATAATATTCGCGAATCAATTCCTCATATTTTAGATTTCATCTGAATT
CAGCAGTTTTTCAAAGCTTCAACCTGTGCCTGCCTTCGCCGCGCCTGCAACACAAGTTAT
CTATGGGGCGGAGTCACAGAGTGTACACAAAAGATAGCGCGCCGCGAAACCCGCGTGTTG
TCGGTCGCTGCCCTAAGAGACTCTTCGGTTGCTGGCAGAAAGGTTGGCTGTGACGATTAC
TATTCCCAACGCTTGGAATGAACCAAAGTGATTATTAACCAATCCTTTTCTGAGCCAATC
GAATTTTTAAAATTTTGGAGCACTCACATTGTATTGAGAATAATAGAAAAGCTGGACAAG
TGAAAGCATGAAGTAATGTTAATGGTTTTGACCAACTCATTTCGTTTAAAGGGATCGTCA
ACTTGAAGAGCAGATTTGGAACAACATTAATATACGCCATTACTTTCGAGAATATATTCA
TCTCCTCCCAATCCTCAGCCTCTGGACGAGGATCCAAATGTTCTGCGAGATCTTTCAGAA
TGTCTTTTGAACGCCAACTCTTGATTTGCATTGGCTCCGGTACAAGACTTGCAGCTCTAC
TCCTAGCTTCATGTCCTTGAAATACATGTCCATGAATAACGACGAATTCTTCATCTTCGT
CTGATAACTCGCTTTCTGGAATTGAAATAAATGTCAATTAATAATAATATTGAATCTAAA
AAAAACCTCGTCTCGAAATACCCAAATGATTGTGTGTGGCGTATGGATGTAAACCATTCA
GATTTCCATCTCCATTAACCATAAAAGATGCTCTTTTCGTGTACCGCCGAGTTGTCTGCG
CTTTCTCTGCCATGTGCTCTTTCAGCTTATCGATTGCACCAGTAACAACTGAGATTTCAG
GGAATGGAGCTTCTGAAATTTGAACAATTTCGGATGATTTTCCTTTTATTTCTAAAAATA
AGTGAAACTCCAAAATACCTTGGTCGTGGACCTCTATTTCTGGAATGACTGGCATCGGAG
CAACACTATGAATACTTTTCCGGCTCCGTAGACTTTTTATACTTTTTCGGCTCTTTGTAC
TATTCTGTTTCTGAAGAGCTTTTCTTTTTCGATTGTGTACAGCTTGGGCTCCGATCACAG
TGATAACATAGAGCAAATATAATCCAAGAAATGCTGGAAATTCGTTTTTTAAATTAAGCT
TTTTCTTTTTAAAATATAATAAAAACTCACTCAACGGCATCCAAAGCGTAACCCGATTGT
AAAAAACAAAACAAAAAGCCAGAAAAGAGAGTGCAACTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved