Caenorhabditis_elegans Locus Mono:25:F56C9.12
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:25:F56C9.12
Caenorhabditis_elegans
Mono:25:F56C9.12
III
F56C9.12
1001..1111
2111
CCTGCTATGAGTCATTTTACTTATTAGTATTTCCTTCCACAGGAAATTGCCGTTTTTAT
TTTTGATAATATATATTCTGAGAAAATATATTTTTCAGGTGACGTGCACGGACAATACTA
CGATCTTTTGAGACTGTTCGAGTATGGTGGATTCCCCCCAGAGTCGAACTACTTGTTCCT
CGGCGATTATGTGGACCGAGGGAAACAATCGTTGGAAACTATCTGTCTCCTACTTGCATA
TAAAATCAAGTACCCGGAAAATTTCTTCCTGCTCCGAGGAAACCACGAGTGTGCCTCGAT
CAACAGAATTTATGGCTTCTATGACGAGTGTAAGAGTTTGATCTGAGATTATCTTAGTAC
AGATTTATTCAAATCTCATGTTTTTAGGCAAGCGGCGATACAACATCAAACTGTGGAAGA
CGTTCACCGATTGCTTTAACTGCCTGCCAGTTGCCGCCATCATCGACGAAAAGATCTTCT
GCTGTCACGGAGGACTTTCTCCAGATCTTCAGTCTATGGAGCAAATTCGTCGTATCATGA
GGCCGACAGACGTACCAGATCAAGGATTGTTGTGCGATCTGTTGTGGTCAGATCCTGATA
AAGTTCGTTTGTGAACATAAAATTCAATGAATGATTACCATTTATTTTCAGGATGTCACT
GGCTGGGGAGAAAACGACCGAGGCGTCTCTTTCACTTTCGGACCAGAAGTTGTTGCCAAA
TTCCTGCACAAGCACGATTTGGATTTGATTTGCAGAGCTCACCAGGTATTACTTAAGATT
TTCTGCAAAGTTGCGAACCGAGAAATTTTCAGGTTGTGGAAGACGGTTACGAATTCTTCG
CTAAGCGGCAGTTGGTTACATTGTTCAGCGCTCCTAATTATTGTGGAGAGTTTGATAACG
CGGGATCGATGATGACTGTCGATGAAACACTGATGTGCTCTTTCCAGGTAAACATAGCGG
TACCATCTATATAATTTTAAATACTGATAATGCGTATGCATTCACCAATGATGCAATGGT
TAAATCAGACGAGTCTATTTTGGCTATCTATTCGAGTTCTTCGAAGAAATTGCCGCTAAG
CGGGGTGAAATTGAGGCATTTGTCTGAGGTGATTTATTAAACGCTAAAACTACCTATCAA
ACATTAAAATAAAACAATTCGGAATATTTTTTTCAGATCTTGAAACCAGCAGACAAGAAG
AAATATCCATATGGTGCTGGAGGAGTTGGTTCAAATAGACCAGTCACCCCACCACGAAAC
GCACCGGCTGCGCAACCAAAGAAGGGTGCCAAGAAGTAATCATCAGTCGATTTATCTATC
ATCTGTAAATACCTAACCTTTTCTTTGTTGTTCACGCCCCAAGAGGCCTCGGCCATCTCT
CGTAAATCGGCTTCAAAAAGTTGTGTACATTAATTTTGATTTTAAACATAGTTTCGAAAA
AGTTTAAATTCGATTCATTATGATCTAGGCTGGCACGAGAAGATGCTGTGGTCCCGGCGA
ATCTCCTCTCAATTCAAGCTTTCGTTGTCAACATCCCTTCCTCTTTATCTCTGTGGACCA
TTTAGAGCTAATGACTCCTCACCAATTGCTGGCTCAATTTTTCATCAAAACAATCCCCAT
TTTATTCGTTTTTAAATTCCAAATTTTAATTTTTTTTGCTAAACTTATCTCTTAAAACAG
TATCAAATTTTACTTCTCTAAATGGTCTAAATATTTAAAACAAATGTTTATGATGTCAAT
CAATCTCCACTCCTTTCCTTCCTCCATTCATTCGTCCATCCCGTACTCTTCGTTTCTCAA
TTTTATATTGTTAAAACCCCCATTTGTCGATTTAATTCATTAAAGTTTTCCGAACAAATA
AAATAGAACACTGGTACAAGCGTGTAAGCAATATTTCTTATTACAACGAGTGCAACGTCT
CCAAGGAGAGCGTGCGAGACGAACAGACATCCCCCACGACTAGTGCTCCTCGAGCCGTCT
CATCGATTTCTGTCGTTTGTCAGTTATTCAGAAATGCTCCGCCCCGGCTCTTCAGTAAGC
TATAATAGGTAATCAGAATGAAGAGAAATATTTTTTGAGTTTTTTCGATTGATTTTCCGT
GTTTAGCTCAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved