Caenorhabditis_elegans Locus Mono:20:Y53F4B.47
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:20:Y53F4B.47
Caenorhabditis_elegans
Mono:20:Y53F4B.47
II
Y53F4B.47
1001..1080
2080
GATTTCTGTCGTAAAAAATGTCGTCGTATCCACCTTCCCAATAACCATCCACTTGTCAT
CTTTCAGTTGTTCACAAATTTCAGCTCGTTTCTCTTCCTCAATATCAGTCATCCATTCAA
CTCTCTCCACAACCGTCTTCTCCTCCGTCGTCTCATCCCAGACCTCATTGAAATCTCGGG
CGGTCGCCTTCCCGGCATTATGACCCAGTCCGGTTCTTCCACGTTGTGTGGAGCTTGCGA
TTGGCTCCGAGATACCCTGGCCGTGTTTTCCGAGTCCTTCTCCTGCTTTGTGACCCATCG
CCGCCATCAACCGCTCCGCTACGGTCAGCGGCTTCTTCGCCGGCGGCTCTTCTTCTGCGG
TGAAGTCGTCTTCCTCGTCGTCTCCGGCTTGATATCCTCGTTTTACCTCAAAAAAAAACC
GATTTTTGCGGTAAAAATAACCCTAAAAATCGATAAAATACCGCTGAAAACGAGGCGCGC
TCCTCCATAAATTCCTCTCGTCTGTCGGCAGCTCTCATTTTCGCCAGCTTGCTAATTGAG
TCCTCGGTCGACTTTGGTTGGAAACTAGAAGTTCGATTTGTGACCATCTGCTCCTTATGC
TGATATTCATCCTCTCCCTCGTCGCTTTTTCGCTGAAATTTTTGATATTGCTAATTTTAA
AATTGGGTGGGCAGGCAAACTCAAACTCACATCAGCCATGTTGATTCAAGATTGAGATAG
GTGGAAAATCTAAAAAATCTTGAATTCAATTGCTATTTTAGGTGCAAAAGCTGGAAAAAC
TGTAAAAATTGAGTAAAAACGAAGGAAATAAAACAAAAAACGATAAAAAATAACGAGAAA
ACACAAAATAATTCAAAACACTAAACAACACGCGCCTCCGTTATTTCGGAGCGTCGTCTG
CACACAACAGACAGCGAGGCGCGGAACCCGTCACTTGTCTGCTGCGGCGAAGGAACTAGC
CGCGACGCCACGCTTCTATTGTATCTACCTTACTCGAAAACCCGCATATGAAGACCACTA
AATGACGAATCCTAATAACCCAATGGGTTTCATTGCGGATATGAGGCATTTGTCTGAGCG
GAGGACAATATTTATTGAATTTTGGAATAATCTGCTAATTGTAGATATTTTATTGAAGGC
ATTCTAATATACACACATGAAATTAGGTTATCACAGGTTAAGTTGGAGCATTTCGTAGAT
TAAGCATCTGAGCTGGAGCTCGTATCAAGCCCAATTATCGGACAATACTGCTCGTCGGCA
CCCTCCAAATATCGATTCTCTATCACTAAACAAGCAGTCTTCCTGTGCTTGCTATGCCGG
TAACCATACAGGAAATATGCCAAGATTCCTGAATAAAAAATTGCCTATTTTTTCAGTTAT
TTCGAAAAAACTCACCAATTAAAGGTATCACTACCAAATGAGCCAAAGTTTTTGTTGGCA
CACTGCCAGCAAATGAGCCAAGGAGCATGAATAATGTGAAGAGAGAGGTGGTTGGGAATA
GGGTTACTTTGGATTCTTTTCTGCAAAAAATCGATGAAATTTGGCAAAAATTTCAAATTC
CCGCCAAGGACTACGGTAGCAGTCGTTTCAGCTGTGTTTTGATTCGATTTTCGGCGGGAA
ATCCAAATTCTTTACTAATTTTCACGTTTTTTTTTAGTGAAAACCCTTGAATTTAGGTTA
AAAATCTAAATTTTTTCGCAGAAGTTCAAATTCCCGCCAAGGACTACGGTAGCAGTCGTT
TCAGCTATGTTTTGGCCAAAGTTTTGCCGGGAAATTCAAATTTCTCACTGATTTTTATGC
TGTTTTAGTGAAAACCCCAAAAAATTTACGTTAAAAATCTAGATTTTTCCAAGAAATTCA
AATCAACCCGCCATTTACTACGGTAGCAGTCGTTTCAGCTGTGTGTTTGTCCAACATTTT
GCGGGAATTTTGAAATTTTCGCATACTTCACGTGGTACCAGGGTGTCCCATTACGGTTTG
ATCTACAAAAAAATGCGGGATTTTTTTTGCCCACAAAAATGTGACGTCAGCACGTTCTTA
ACCATGCGAAATCAGTTGAGAACTCTGCGTCTCTTCTCCCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved