Caenorhabditis_elegans Locus Mono:5:T27A3.9
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:5:T27A3.9
Caenorhabditis_elegans
Mono:5:T27A3.9
I
T27A3.9
1001..1076
2076
AAATTTCTAACTTTTTCAGAAAACCTGCAAACGAAGACGCGAAGCTCGAACAGATTATG
TGCCTGCAGACACACCTGGATATTTTGTCAACGTCGCTTTTCCTGCTTATGTTAGACATT
TAGAAAGGGCGAGGCAAAGAAGTATGAGTCTGATTCCAATTTCCAATTAAACATTTTTTG
TTTAAGGTCGCACAGATTCCCGATTAACATTCATCGATGTCTCGGAGTCCAAATTTGATG
ACAAGAACAAGTCGATAGTTAACTTTAGACAACAAATCCTTGATGATCATATAAAACTGA
CTGATGAAGTGATAGATGTGAAGGTTGTGGATCAGCTTGTTAGTCAGTATGTTTTAATCT
TTTCAAACTAACAACAATAACCTCTCCTATTTCAGCCCTTCCTGTGGAGCAATATCCACC
TTTAACGGTGTGACACGTGATAACCATGGAGGTCGTGACGTCAGCAACCTTTCCTACGAT
TGTCACGACTTGATGGCATACAAGAAGCTACGTGGAATCTGTGCAGAAATTCGAGCGGAA
TATCCGGATGTTAAGAAAATCGCGATTTTTCATCGTCTAGGAAAAGTAGACATCGGAGAG
TCATCTGTGATAATTTCCACGTCTTCACCACATCGGAAGACTGCAATTCAAGCCACTGAA
AAATGTATTGATTTATTGAAGGAGCATGCACCAATCTTTAAATACGAAGAATACTCGAAT
GGAGAAGTGGACGGAGTTTGGAAATCAAATATCGAAGATTCAAAACAATGATTTAATCTG
AAGATGTTTTTTATAATTTTTATGGATATGAGCTTATTTGTGATATGTACATTGTACATT
TTTGAATAGATGAACTTGCTAGCTAGAATTTTAGAGAATAAATGTTTTCTTTTTCTCCTT
CGCCTCATAACTGCACTTCTTTTCAAAGAGAACCTGACATGAATGGTGTCACCGGTAGCG
TGTGTGTTTTGTGTGCAGCGGGTCGCTGGTTCGACCCCCAGCCGTCGATGACGACCAAGA
GTTATCCCTGTCTGAATGATTGTGAGGACAAAAGACTATGGTAACACTCCGAGACTAGTT
TTTCATTTTATTCTATAAAATTTTGTTTGAAAATCATTTATTGCATTAATACATGGCTCC
CGTAGATACAACCCATTTGAATCATCGTATGCTATTTCTTAAAGCATCAATTCAAGTCAA
CTTGCTGCTCGTATTCTTCCGAATTGAAAGTGAAGACTATTTCTGAAAATAATTTTTAAA
ATTGGAATATTTTGGAAAAGTGTACCATAAGAAAAAATATGCAAAAGAACTTTGGTAGAT
ATAACAATTGAAATAATTATACCAAGAAAATCCAATAATTCAGTGTTTATCGCCAATTCC
CACATCCATAAGAAGCTGACTGATAACATCATTCGGGTGATATGAAGTGATAGAAGAAGG
AATTCACAGATAAACTGAAACATTTAGAATAAAAATCTCAAGATATTCTATAATTTCTCG
AACAGGACAATTTTCAGAATCAACATAAGGTTCGTGGTCCTAAAACGTTGCTAACTACCG
TAACCGCGATTTTTTTTAACGGTAAATACATTTTTCTAAAGTTACTGTTTTTTGAAGGAA
AACTATTTTCAAAAAATTCAAATGATATGTATAGAAAATACAGTAAAGTTGGGAGAAAAT
GACAACAGTTTCTTACTGATAGCTACGAGATCTCACAAAGTTTGCTAGGACTGTTTTGCA
AAAAAAAACATGTTTCATCCCGTAATTCGAAAAAGTCAAATTTCAAACATCATTCATTTA
TTATTTATTGTAGCAGGAGGTAGGCAGGCAACTATCTTCGGGCCTACAGATCTATCTAAC
TTACACTTATCACAGGAGCTGCATGAATTGCGATGAATGATGGAATACTGGAAAAAGTGA
GGAAGGCGAGTTTTACTGGTAGGAAAATCATCTAAAAAACTCGTATGAATGTTGATAATT
TGATTTTAAAAGAAATGAGGTGAACATCTTAAAAAATAAGAAATTGTATGGAAAATATTA
AAGAGGATTATATGCATTTTTTGAAAAGAAACCTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved