Caenorhabditis_elegans Locus Mono:31:F32E10.10
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:31:F32E10.10
Caenorhabditis_elegans
Mono:31:F32E10.10
IV
F32E10.10
1001..1070
2070
GGTCATGAAGAAGTATCAACTACAACAGAATCGACTACAGTTGCTGTCAAAGAAGTTCC
AGTTGACGAAATTGAAAAGATTGCAAAACTCGAAGCAAAGCAGCATACAGAGGATGAAAA
AGTGACTGTCGAAACCAAACAAGAAACTGCAGTAACTCCAGCACCGACCACTTCAGAGAA
GACATCAACCACAGCTGCACCATCTACAAAGCCTGCAGAAGAGACAACGACAACTACTGA
AGCCCCATCTACCACTACTAAACCCGTTACAGTTGCTGTGAAAAAAGTGAGCCCAGAAGA
AATGGAGAAACTTGTGAAAAAGGAATCAACTGAAAAAGTAACACTTCTGCCACCACTTCC
AACATTTACATTCCCAACATTGGCTCCATTTACGTTCCCAACACTTCCAACTCTTGCTAC
AACAAAACCTTCTCCGGCTCCAAAAGTTCCAACATTAGAAGAAATTCTTGGAAATTTAAA
TGATCAATTCAAGAAACTTCTGTCTCCACCAAAGCCATTGCCAAAGTAATTAATAATTCG
TAGAACTCGTATTTTATTTTTACTGCTCCAAATTATGGGTATTTGTTGTTAATATTTGAT
TCATTAATATATCATCGGATAATAAAATTAAGTTACACATTAAAAAGATGTATAATACAA
AATCAAATTAACTAGCAAGTCACATATGATCAGTCTATCCAATATTACAAAATAGCTTCA
CAACTAAATTTTATTGTTGTAGTATTTCTTCATACATTACAGAATCTGAATCTTGGCAGT
ACGTTGCAAAGTGAATCTGCTTTGAAAAAACTCGACACTGAAATCAAAATGCATCAATAT
TGCATATTTTTTAATACGTGTCATTTTTTTGAAACACAACGCTGACTTCTCACCAGAGTG
ATCACTGTTTTTATACACACAAGCAGACATAAACGAGGACGGCCTTGTGGCGCAGGCGGT
TACTGCGCTGCTGTGGAAAATTTGGCCCAAGTTCGAATCCCAAGCAGTGATGATTTTATA
GTTCAGCTTATCTTCGGATTTGATGAGAAATTTCGCCCCTATCAGAGCTTTTTGTTTGAT
GAATTATCATGAGATAATTTGTAGAACTCGTTTTTTTTTTCTGCTCCACATTATGGGTAT
TTGTTGGTAATATTTGATTCATTAATTTATCATTGTTAGGAACATTGCACAAATTGGATT
TGGACACTTCTATTATGATGTGGTAATTTTAAGTAAATTTACCTTTTTATTTATTTAAAA
AGCCAACCGTTCATAAAATATAATTACAGTTATAAATATTTACATGTAAATTTAAAAATG
AGATTTCACACGTTTTGACTTCTTATAGATAACCACGTTCGGTGATTTGTACATGAACTC
ATAATTGATGCAGTAAGCCAGTAATTGTGTGAGTTCATTATTTGCAATACGGGAAGGTAA
AAGAGAATTGCATTCGAGATCCAGTTGGCAAGATGATACTCTGAAAACAAAAACAAAATA
AAGCACTTGATATTAGGAAAACTCACATTTCACTGACAGATTGCTCCACAGATGTTCCAT
TCATTTGATAAATCTCGCCCTTTGTTGGAATTTCTTTACATTTCCTGTCACGGTGAAATT
TGACAGGAGTTCCACGAGGAAGAAGTTCTTGAAGGATTTTAACGCGAGAATAATGAATGA
ATGGAAATGATTTGATTGAAACAAGGGTCACAAAAGGTTCCATATTGACTTCATCCTTGT
TAGGAATGTTGTACACATCGGATTTGGACACTTCTATACTTATTCCATAATCGATGAGTA
AAAGCTGAATAGTCGAGCCTTCCTCTCCACAACAAGAAGCTCTTTTCATGGTGCCTTGAT
GGAATACAGAGCATGATGTACCATAAGCCATCCAGACGTCTGGTAACGATTCTAGGGATT
CTTTCTCTTTTGTAAGATACTCCTCCGCTTCACGTCTCCTTTCAAGCATATCTTTAGAGG
TAAGATAAATAATTCGTTCATTTTCGATTCGCTCGACCTGAAAGAATTAATTCTCATTTC
TTTATCTGAAATTTTGAATACTGTTTTTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved