Caenorhabditis_elegans Locus Mono:13:K02C4.7
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:13:K02C4.7
Caenorhabditis_elegans
Mono:13:K02C4.7
II
K02C4.7
1001..1074
2074
CTGTTTTTGCCTCATGAGATCCGTCCTTAGCGTTTCTAAAATATATTAATTTTTTAGAA
TATATATAGTTTTCTTTCTGAAAATGTTCAAATTCAAAACTTACACTAAATGTCGAGCTC
CCCAATTACACTGCACAAATCGCCAGGAACCGTCCAAAAATACAGCGTTCCATGTGTTTC
TGAAGCGATGATCATCAAATGAATAACCAGGTTGATATCCAGCTGATTTTGAGAATCCTT
TAATGACGACACAATGAAGACCAGCGTAACTGAAATATTGGTCATTTTGAGAAATGTGTT
CGTTAAAACCGACCTGCATAATCTTTTGAAAAGAACATGATAACTTTCAGTTCCATATTT
AATTCCTCTTAGCAATCCCATTGGAGTATCATTTTGAATTGAATCATCGAAAATCATTGT
GTTCAAATTTTTAATTGTAATCCATCGATAAATTGCTCTTGCCACGTCAACATCTGATCT
TGCTCCAGACGATAGGGTTCTAATTAGATCTGTGAATGAAGCTACTTCATTTCTAGCACA
GTGAATTGCCACCTCATCGATGCTCTGGATAATTAATTTGAATTTATTCAACAATATTTA
TTTTAACATACCGAAAAATAATCAGTTGTCGTATAAATTTCTCGTTTGCTGCAAGACGGT
GGAACTGGCGGTGGAGGTGTGGATGGGTACTGTAGGTTACTGTACTCTGATCTAGATGCT
TTGAAAAGTTCCAGCATTTCTTTAGCTTGACGATCAACTAGCTCAGCTGTTTGATGACGT
TCACGTTCCTGCAAAAATCATGAGTGTCACTTTCCAATTTCTATTTGACAGTTAATCTTT
AAAGAAGAGATATCTTTACCATCACTAAGGTACTTTATAAAGTATTTCCTGCCAAACAAA
CAGAGGGTGGAGTCGAGCGCGCTCAAATTATCGAGTAGTGCGAAACCCGCGAGGTGTCTT
CTGCTGTGTTTCTGATGGCGAAAGAGAGAGACTGCGACGGCAAGCAAATGACGAAATCGC
ACCTCGGCCCGACTCCAACCCTGGGGGCGAAATGAGCTTTTTAACTCAGATGCTTCAGTA
ATAATGAGGGAACAAATTTTGGAAAGTTCATGATGAATGTATGAATAGAAACAGAAAAAA
TTACAAACCTTTCGCTTGGTGTGCAATGTTTCCAACTTCTTTTCTCGTTTAATAGTCAAT
TGCCGGATAAGATCATCTTTTTTCATATTCGACTGTCCTTTTTCATATTTCTTAGCGAAT
TCAGCCAGAGCTTTCTCCCATTCTTCCGTATTCTCTTTTTCAAATTCTTCAGCTTCTCGT
ACTCTTTTATCTTGGAATGACTCGTACAAATCGTCTTCATCTTTTCGATGCAACAATTCA
AGACGTGTTTGAGTATCATAATCAACTACGTATTTTGCTCCTTCGTGACTAATTTTTGGG
TACGGTCTTGCAACTTGTGTAGCCTTCATTGCATGTGCTATTTTCATATCACTGAGACCA
GCGTCACTTAAAATAAGAATATTAATTAATTTGTACTGAAGATGTAAAGTATAATACTTA
CATCCAATTACCATTTTTTACATGATTATTGTTCTCCAAATTTTTTCCGGAGCCATTAGT
GGATGCCATTGGTAAATCATGTGGTCCAGCAATTGGAACATGATTTGAGCAATACACTTC
TTTATCATTGATATCATTTCGATTATTACAATATGTTTTCAAAGCAAGACGTGTTCCACA
AATGTAACATTTGAAGCAACCTCAATTATGAATGTGATTAGACTGGTTTTACAAACCTAT
TTTCTTTTGAAAATTGTTTCGAAAAGCAATTTTTAGAAAATTTTCAACACCTAAACCATA
AACCATTCCGTCCCGTGAAATTACTCACCTTGATGAAAAAATGTAGAATCCTTAAGTGGA
CCAACTTTATCAGTTGGATACACTTGTTTTCCGCATCTATTGCAGTGTTGTTTCGAGTTC
ATTCTCGTCCAGAATGACCACTTCTTTCACTTCAATACTTCTCACACTTTTTCTCGTTTT
TTGCCTTCTAAAAAAATTGTGTTGAGTTTGTCTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved