Caenorhabditis_elegans Locus Mono:6:T02E1.9
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:6:T02E1.9
Caenorhabditis_elegans
Mono:6:T02E1.9
I
T02E1.9
1001..1071
2071
GCCAGGATTGGAAGAACTCGAAGCTAAAAGTGATCCAACTGGAGCCGAAGGATGAAAAA
ATATAATTTATTTATCATTCGACCGAAAAGATTCAAATGGGAACTTAAAATTAACAAATG
ATCATAAATTAATTAGAAAAATGATCATAATTAAACTTTCTTTCGGTATCTTTCAATATT
TCGCAGCGAATTTGTATCCAGACTTGTTTTACTGTAATTCCATTCAAAATTTCCTGTTGA
AAATAAAGAATAAATAAATACGAAGAAAAGTGCGCGGCGGCTTGCGAAAAGGCGCGCCGC
ACTGTGCCCTACGGAACGCGTCCCTTCGGAAAAAATCCCCTTCGGAAAACGTACCCCCTC
TGTACCTGGAGTTGGTACATTTTCGTTGGAGAAAATTTTGGTTGGATACCATTTGCGTGG
AGCAAAGGTGCGGCGCGCCTTTTCGCAAGTCGCCGCAAAGCCTTTTCGCAAGGTGTCGCA
TGTTTTTTGAGGAGACAACAACTGCGATAGAAAAGCGTGCGGCGGTTGCAAAAAGGTGCG
CCGCACCTTTGCTCCACGCAAATGGTATCCAACCAAAATTTTCTCCAACGAAAATGTACC
GACTGCCGGGCTCAAATCATAAATTCATAAATTCAGTCGGTGAAAACGAAAAAAAAACTG
CTGTTAAGATAAATTTTCAGATTGAAAAATCAAAAATATTAAAAAATCCGAGATAATTGT
TATCGCGAATAAGCCTAATTTGCAATTAAACATTAAAACTGCTGTTTAACTACAATTTAT
AGTATTTTATAAAACGAACTCGTTTAAATATTTTAATACAAAATTAAGTTATTGCCATCA
AAAACTATACGAAAACACCTATTCTCAATCTTCCTTTTCTATTCGGTACACCCTGCATTC
ATAAGCAACCTCCTGTCTCTATGGAAAATTGACTCGATGGCGCAACTGGGAACGCACTCG
CCCGTCGTTCGGGCGGGTTCAATCCCTGCTGTGGCGCGTTTTCCACATGATGATACAACC
ATAGCATGAGCTGGCAGCAGTGATCGCTAAATGTCATAGTTACACAGATGGGTTTTCGCT
TTTTATTTCAAGAATTTTTCAGCAATTTTTAGGTCTATTTATGCGGAATTTCTGTTCAAT
CGAGATCTTCTACAGTTCGTTCAAAGTCTTCTTTCACTTCGCTCATTTTTGCAATTGGTG
CATATCCCTGCTTCATATTCTTCCATGCTGTATGTACAAGCCAGATAAGCTTGAAAATGA
CAGAAAAGCAAATGAATAGAATGTAAATTATCATGAGTGGGGTAATCTTTTTATGGCGGA
AGTATGCATTGAGACCTTAAATGGTATAAAAATGATTAGTCACAACAAGAAGAGACTTAC
CATCCGAATGAGCTTCTGCGCTACTCTCATTTTTCTTCTGGACTATGAATTCCTGTGGAT
TTTCAACCCATCTGTTTTCATGAACATATCTAACTGCTTTTAGTTCTTCCGCTGAAAAAA
CATATAACTTTAGTTTTCAAAAAATGTCAAGTTACCTGTCGGTTTGTAATAAATTAAATA
ATCAGCAATACCAGTATTCTCGAATGCAAAGTAGTCCTAAAATTTTTGATTAAATCTTGT
TTTCTAAACTTAAAAATTTAAGTTTAAACTTACAAACATACTGTATATTCCATCAAAAGA
ATTCGAGTAATATCGCTTGTTTAGAACTGTAATATTTCGAATTGATTTCTCAGATATTCT
AAAGAAAAGGCCCTTTTATAGACTCAAAATTGAAAAAAAAAGTTATTAAATCTTACAATA
AGGTTTTTCATCAACAGTAAGACTATCCTGTGTGTGCGGCAATTATTTTTGGCGATTATA
CAAATTGGCCGATTGCGGCATGTTGTTGCAATATTTTTATTAAAATTTAGTGACAAAATA
TAGAAAAATATTTTATTGATCTGAAATTAACAATCGTTTCAGTTTAAAAATGTTGCCGTC
AAACTTTTGGTGGCAATTTTTCCGCACTTTTAATCTGAAACAAATGCCATTTTCTTTTCT
GACCATTAAATATTTTCTCTGAATTTCGACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved