Caenorhabditis_elegans Locus Mono:22:F30H5.4
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:22:F30H5.4
Caenorhabditis_elegans
Mono:22:F30H5.4
III
F30H5.4
1001..1086
2086
CGGAAACCCAACGTCGTGGCCTTATGGGAATTGCGAATATAATGCACTCGAGCAACAAA
CTGTGCTCCGAAATTGTATCGTCCGAAGTGTTCCGTGTCCTGGTCGCCGTCACAAAGCTC
GGCACTATCAATCAGGAACGGGCAGGCTCGACGGAACAGGCGAAACGTGGATTGGAGGCC
GCCGAGAAGTTTGGACTGATTAAGGCGACGGATCGAGAGATTTATGAACGCGAAAATCAA
ATGAGCACCATTCAGGAATAATTTTTGTTTGATTTTTTTTCTCACTTTTTTTGGAATTTT
CTGCTATATTTCATCCACGTGGATTTTTCAGCTATTTTTAAAACTGAGAAAATTAAAAAA
AATCCTTACGTGGCTTTTTTCTACAAAATTCAAATTCGATTTTTTGATTTAAAGCATCTT
TACTCAATTTCCACGTGGCAGAAAACCCAAAAACGATTTTTAAAAGGTTGGCTTTGATTA
AATTTTAAATTCCACGTGGCTTCAAAGTTTCGAATTTTTTTAAAATCTCAAAATTCCACG
TGGCAAAATGCTTCTTTCAATTTTCCTTGATTTCCCCCACCTGATCCAAGATTGTTTTTT
GTTATGTTGTACACATCTCTCAATCCTAATTAATTGTGTTATTACACGTTCGTAAAGAAC
ATGTAATATATGTATTCTTTAAAATTAAAATCCAGTCATTTTCTGCTTTACCCCGCATTT
TGTTTCTCTGTTCATGTGTAATGATAGTGCCTTAAATGCCTTCTTTTCTGTCTGTTTTTA
GTTAAATAATTGATAAAATGTTTATAAAATGAATTCTCCCGCTAAAATTCCATATGAAAA
TCAAGTTTTGTTGCAAAATATGTTGCCTTTCCTCCGCGCCGCACACTATCACTTTATATT
TCCCCATTTACTCTTCTCTCTGCGACTCCTGCGTGGATCAGTGGTTGTGGTCGCCGCCTC
GGTTTGGCGCGACCGTTGTTCGACCCCCACGCAGTGTTAATGTCCGTTGATGACAACATA
CATACACCATTACGATCTCTGAAGACTTCGTGCTGATCATGTATCCATGCAACACCAACT
GAGGACAACTACGAATGAAACCAAAGTAACTTAGGCTTTAGAAAAAACACATTTTTTTCT
AAATTTTTGTTTTTGTTTATATTGCTTGGCTAAATGTTTTAATATTTTCAGCGCTCTCTC
TCCGTTTGCTGATCCATTTATTAGGTTGGTCGAAAAGTCTTTGCAAAATTTGTACTTTTC
TTCATTTCTCAGCGTTAATTCATTTTTTTCTGATTCGGTTTTTGATTTGCATAGTACGTA
ATGTGCATGTTTAATATATTTTTTAAAAAACTTTTGGATGCTGTTCAAAATGACCGAGAA
TTTGCTCGCCGAACGTCACGCCCTCCGATGGGTTTTTCTGTACGAGTTCCCCCAAATCTG
CAATTGCAACGAAGCTCGTCGTAACATGTGTGCAGTGTTAGGCAAGAACTCTGTCACCTA
TAATACCATGAAGTTTTGGTTCGAAAAGTTCACGAAAAAGAACTACGATCTCGATGATAA
ACCAAGATAAGATCGCTCTCGTTTGAATATCGACGAGGATATTTCGAGAGCCCTGGAAGA
TGATCCAAGAGCAACGAACCGCGAACTTTCTGCGACTCTCAAGCATCCCCAAAAAACCAT
CATCAACCATCTCCACGAAACCGGAAGGGTAGAAAAGTTCGGTCAACTCGTTCCTCACAA
TTTGCCCGATTCTCAGAAAAATTGTTTTGTGACCTCTCTCTTTCGCTGCTCACTAGGAAA
CGAACAACGGACTGGGTTAAGGATATCATTACTGGAAATGATAAATGGGTATTGTATGTT
AGCCATACCAGGAAAAAAGAGTGGGTCCCGGTCGAGGAAACCGCGACACCTGACCTCAAA
TTAGAACTTCACGGAAAAAAGTGCTTCTCTCAATTGGGCGGGACAGTAAGGGTGTCATTT
CCAGAGAGCTTCTTCTAGACTTTGCTACAATCAACGCTGGCCTATACTGCATTTAATTGG
AAAAGATGGTCCATGCTCATCGATTACATCGCCCTAGAGGATCAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved