Caenorhabditis_elegans Locus Mono:1:Y39G10AR.24
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:1:Y39G10AR.24
Caenorhabditis_elegans
Mono:1:Y39G10AR.24
I
Y39G10AR.24
1001..1065
2065
TCTTTTTGTAGATCTTGTTTTTGAACAGATCTTCAAAACGTGGTGCCTCCGCAGTGCGT
TTGGAAAATTCAAAAAAAAAAGATGATTTTCAGCCGTGTAATCGACATCTTCTCGAGCCA
ACTTCTCTACCCGAGTGACGAGTTGGAGTTTATTCTGCAAACTTGCGAAAACGATTTACC
AGCTGGAAATGGTGCTATGAACTCGGCCGCCATCTCGCTGCTCCCCATCACTATGGCCTT
GGCAACTGCGAATCGAATCTATGAACTTCTCAACGAAAAGGACCACGTCATCCTTCCCGA
CCTGACACGTCGAATCCTCCAAAAGTACACTGCAAGTATGATTGAAAAGTCGAGACGCGG
TGAAACGGAGACCGAGTACACTTTTGAGACGACCCTCCCGTTGCTTCGTATGTATAAGGA
GGGATTCATGAGCAAGAGACCGTGTATTTGGACTTGTGAGAACTCGAACACTGTTGGAGC
AAATGTTCAGGCTCGTGTGCTCACCTCCCTCGAGTTGCAGCCATCTCTGGAGCATATCAA
TCGTCTTGTGAATGATTCTCGTCCAGTTTGGACGGCTACCGAGGAGAAGCCTGCGATGAT
CAAGGATTTGAATGCCGATTACACTGTCGTCCACACTATTTTCTCGTATCTTCCAAAAAT
GTGAACGTATCAATAATTTATTTGTTTTATTCCTGTGAATTCACATGTTCCCCGATTCCC
CGATTGATTTCTCGCTTTTTATCAACCCCGTATTCTTCTGTAACCGGTATTGTTTTTTCG
ATAAAGATTGAAGTCCCATTTTCGTAAAAAACCGAAAAATCTTTTTAAAAATTGCGATCG
AATTTGGAAGAAAAACGAATTTTGGAGTGTTTTCTTCAAAAGCGAAAAGTTTTCCGGCGG
CGTTTGTAAACACATTGTATGCAATTGGTCAAACTGCGCGTCTGGCGCAGCCGGTTGGCT
GTTCGCACAGTAAACTGTAGCGCGCTGGTTCGATCCCCACCAAGCGATGACGATTGATAT
CTGCTCTAATGAGTCTGAATTACCATGTTGAGATCTTGTCTGAGCTCCTTTTTGGCTTTT
ACACGGTGAAAAGATGAACAAAAAACTTGTTTTTTTTAATTTTCACTTTTTATTCCGAAA
ATGACACTTAAAAAAGCGTTTTCAATAGTTACTAGATGTTAAAAATAATTCCTTTTTTAA
AGCTATTTGCTTTTTAGGCTAATTTTATAATTTTCAGCTTCTACACGTTTTCGACAAAAA
ATAATTTTTCAAGTTCTTGATAATTTTCTTTTAAATTTTGAAAAGATGGGTCGGGGACAT
GACCCCGACCCCGACCCGGCAGACCCAAAAAAAAATGGGACGCCCACTCCCCCTTTAAAG
TCGTAGAAGTGGAAAAAAATGGGCAAACACTCTTTGACTACCTTCTCTTTGACTACCTTT
TGCTCTTTGACTACCTTAGATCATTGACTACCTTTCGGCTCATTGACTACCTTCAGTTGC
TCATTGACTACCTTCAGTTGCTCATTGACTACCTTTATCTAATTTTTCAGAATTTTCAGT
TTTTTTCGCTGAAAAATCAGAATTTTCAATAACATGTTACTTTTTGATGTCTAAGAAGGT
CGTGCACTTTCTCATTTCCTAAAATTCCGGAAAAAATGGAGATGAGATCTGATGTATAAA
TGCTCATTGACTACCTTCAAATGCTCTTTGACTACCTCTATCTAATAAAATATTCCAAAA
TTTATTTTTTTGAAAACTTTTCCAAATTTGATCAGATATTATAGAAAAGTGCAATTTTTG
TCGTTTTTCTAGTTTGGATGTTCTGCACACTATTGCAGACGAAAACCTGAGGTATAGTAG
AACCCCTAAGCTCAAAAAACGCACTCACTTCGGATGCTGATATCTCCGTGATAAAAAAAT
TTATGGCAAAGTGATTAACTACAAAGTTGTATATCTTAATCTAAAGTACAACTTTGTAGT
TGATTGTTTTTCATTAAAAAATTTGTTGGTTGAGATATGATCAGAAAAAGAAGAAGAAAA
TACAAGCATGAAGGTGTCAAACTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved