Caenorhabditis_elegans Locus Mono:37:B0213.18
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:37:B0213.18
Caenorhabditis_elegans
Mono:37:B0213.18
V
B0213.18
1001..1106
2106
ATGAAAAATTTTTTGAGATTTTTCGGAACTGCAAAAACTAATTTTGGAAAAAATCGGCA
CCCGGAGTCGAACCCCAGACTTAAAAAATATTAATCAAACTCGCTAACCACTCGGTGACG
ACAATTTTTCTTGTAAATGAAATAAATGACAAAATCCAGAAAACGTGACTCTTTGATATC
TACTTAAATATATAGGGACGTGAGAAATAGGAAAATGAGAGAACGCAGAGAAAAATTTTC
AGAGCGACTTTTTTCCAGGTCAAAGTGCTCCTCTGCCGCTAAATTTTTTGTAGGGGCCTA
CTTAAAGGGTCTTCTTCGAAATGGCATAGGTTCCATTCAGATTAAGTTGAAATACTTCCC
TAGTCAGGTATTTTTTTGCTTTTGATAAATTCAAAAGTGAGAACTTTATGGCTATTCAAA
ATGTTGAAAAGAAATCCTTATAATAGTGGCAAGCTCAGATTTTGCAAGTTTGTCATTCAA
CTGCAAGACGAAAGTTTACAAAATTTTAGATTGTTTGAAATGGTTGATTTTCTGAATACC
AAGCCGCCATAAAAAGCTTTAAAAGAAATACTTGAGATGACCCTATTTGCTAATTTGGAG
ATATTTTGATCTTGTTCGTTATCATCCCTTCAAATTAAAAGAAATGAAATTTAATTAAAA
AATGTTTGACTGAAGAAAAAATTCGCAACAAAAGAATTGTAGGTAATTGTAGGTATGAAT
AATTTTTGAAACTGTGAAAAATTGCATTTTATGATACTTACATTTATATTAGCATTCAAG
TATGGTGTCTTGGTTCTGTCAGTAAGGGAGACTCCACGTGTTCCTCCGGTAACTTCTGTC
AGCTCTTTTCTGAGCTTTTCCACAACTTCTGGATGGTTCAGCAAGCACACACACGCCCAG
GTCAAAGTAGTAGATGTGGTCTCCTGACCCGCTTGCCAGAGATCAAACAAATCTATAGCC
AGTGTCTCGAGACTAAAACATGCAATAGAAAATTTTCGAATTATTGAGAGAACATACGTA
AAACTAGAGTCAATGCCTTCTTTCTTGTCCTTCTCCATTTTTACAATAAATGCGTCTACA
AAATCGTCGCCTTCTTCACTGAGAGTATGAGTTCCATTTTCGATAGCAGCAACTCTGAAA
TTTCTTGAAATTCACTTTTTCTGTCAATTGATTAAAAAAGTACCTTCGCTGTATTCCTCT
GTTCCCCAATTCAAAAATAAAGTCAAACGGAGCGAATGTTATTTTTGTCCTCCACTTCAT
TAACGGAGATTTGAGAACCCAAAGCGGTAGAAAACCTTCGATTATTGATATATTTTCGAG
TGCCTCTGCCAGACTGGTTTTCAGCTTTTCAAATTCCTGATCGTCCTGCTCAAATCTCTC
AGAAACTAGCAATTGATTGATAATTGAGCCAACGAGTAGATCAAAAATTGATGAAGCATT
TACCTGGATTGCTCCATTTTTGAAATGTGTTCTTTTAAAGTCTTTAAATCTATATCTATA
TTCATCCATTATTTTATCCTCCATAATTGTTCTTCCCACTCCGAAATTTCTCAAAGTCAT
CAGAGCAAATCTTCTGTGCTCCAACCAGAAATCTCCATTCGACCCAATGATTCCGCGACC
TTCTCTGATATATTCCATACCACCTACTGAATATCGAGTTCCAAAAATATTCGCTCTCTT
GACATGAGTCTCATGAGCAATATCATAGTCACAGATGTATACACTGGGCTTCGGGCCCAT
CCAGACTGTGAAAACTTTTCCATATTGCTTTTTCAATTCATTGAATGCCGCCACCAAACT
TCCAGTTTTCCAAGAAAGGTAGAACAATTGATGGAAATTGCCAATGAGCGGGAGAGGAGT
TGGTCCTTATAACAATTCAAATATTATTATTATTCCTTGAAATTTACCTTTCGGAAGTTT
TTGTCTGGCACGCCAAAGATTTGCAGTCAGGACTGCCGCAACAGCCAACAAAATTAGTAT
CAGTAACATTTTTTCTCTGAAAAAAGAAAAACTTCAACCCATGTTTTTGACAGCCACCTT
ATATACGGCAGATAATGAGGGAGTGTGTGAGGAAAGCCGAAAATCGACGAAAGAAAAAGA
GAAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved