Caenorhabditis_elegans Locus Mono:29:W05B2.9
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:29:W05B2.9
Caenorhabditis_elegans
Mono:29:W05B2.9
III
W05B2.9
1001..1084
2084
GCCAAAATTTTAGAGGGAATTAAAATTTTCTATACACCATAACTCACATTAAATAGCTC
GGTGTACTTCTTGTGCCAAACCTTCCGCCAGCTCCTTGCCACATCCATTTTCAAGTTCTC
ATTAACCACATGGAACGGGATATCAAACTTTTTCACAGTGTTCAAATGAAATCCCTCCTC
ATCCGGTATACACATCAAAAATTGCACATTTTCCTGCGGCCAGTAAGTACTTCCATCATC
CAAAGTGAGAAACGGTGGTGTTTGAGCAGAGTATCCATCTTTCTTGAGGAATAACGGTGA
AATAAACGGAAAAATGTTCCAGAACTCGGAGAATCCGTAGAACACCACGATAGTGTTGAT
GGTTACAGAGCTAGTGGAAATTGTGGAGTGATAGCTCCGCTCGCTGTCGGATCCCCCATT
TCCGGTGGTGGCAGGTGACAGAACTTCGAAAAGGATTCCTGATTGGGTAGCTGCAAACTC
GTCGGATCGAGTGACCATCTGGTCTCGGACGAAGACATCTGTGTAGACCCAAATTATTTT
CTCCGGGAAGTTTTGGAGGGTTTCTTTCAGGGTCTCTTTTGCCAATGAGCCAACGCACCC
GGATATTTCCCTGCAAAAATTTTTAGGTATTTTAATCATACAAGATGAAGGCCTACGTAC
TTTCAATTTTCGTCTAACATTTTATTTTTTCGTCTAACATTTGTCAATTTTCGTCTTCTG
TTTTTTCGCCTTTTCTGAAAATTCGAAAACGTTTGTTTTTTATTTTTGATATTTCGGGTT
CTCTCGAATAAAAGGAACGAAAATTATTTCCGGGTGTATCAATTATCTGGTCTAGACATA
AGGTGACCCTTCCCGGTTCACGGTCACATGAGACGTCTCCATGTCATCGGCGAAGAGTCA
TTGTCACATTCAGCGGAACCCCTACACTGTCTGCTGCGTATCTACAGGCCCCTATATAAG
TGAGTAACCAAACCAGTATGTGCTATCCGGTAAACCGCCACCTGCGATGATGAGAATCAT
GCTAATCATGAAGAGACTCGTCAGTCTCCAACCTCCATGTTGTAAAACAATCGATAGCTG
AGCAGAGAGATTATTCATTTTGACTAAATTCATAGGTGTTTGGATGACAAATTCTGGGTC
TTGAAGGGAGAGATTTCAGCGTTCAGAGAAATGTTCCGGAGCTATTTCCCCTAGTTGTCT
TACATGCAAAACTAATTTTCAATTGGTGTATAGGGATTCAAGACTAAAAGAGGAAATACG
GTTACTGATTCCGAACTTTTTCCTCAGATTTTCGGGGTGTTAAAAAATTGTGGTGTCTAG
GTCTAGGTCTAGATGTAGGTAGGATCTAGGTGTTTAGCCTAATTTTGTTTAATTTTCAAA
TAGTTAGGCTTGAAGACTATTGAAAGCCCAAATTTTTTCTTACCGATTGCGAATCTTGGC
TCCAATCTTCTCCAAGAGCACTGAATGCGGTGAAGATGGTGGCTGACCAGTGGAAACCAG
TTGAGCCGGAAGTTTCGGGATTGAAGAGGTTCTTACACTCGACAAGGGGCTTGTCTCAAA
CTTAAACGCCGGAGAAACTTCAACAAATTCGTGAAATACTCCGAGATGCTCGACTGCAAT
GTTAGTGGGCAGTTGATTCTTGATCTCATCAGTAGACGACAGGAATAGCCTTGGAAAGGA
TGTTACCTGGCTTGCAAGGATTTTGAAAAGCTTGAAGATCAACTGAGAGTCCAATAGATC
AACGTTTTCCAGCAGCACAAACCAGCTCGACATCGCAATACCCTTGGTGACTCGCTCCAA
AAACGCCGGCTCCAGGAGCTGGTGGGAATTTACTATCCGTAAGTTGGAGCACATACAATT
GGCGAGCCTGAGCACAAATGACCGCGTTGAGCACATTTCTCCAATCAAGAGCACAATATG
CCCACTGCTCCAGGAGTCAGCAAGAGACCTAGGGATGAAACGATTAATTTCAGTAGAATA
TACGAAATCAACTGTGAGCAGGGACTGCCGTTGAACGCTTCTGTGCTGGATGTAGTAGGT
TTTTTCCTGAAAAACAAAACTGGGGTTACCTCTATTATTAGTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved