Caenorhabditis_elegans Locus Mono:18:B0334.12
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:18:B0334.12
Caenorhabditis_elegans
Mono:18:B0334.12
II
B0334.12
1001..1070
2070
GCAAATGGCCAATTCGGCAAATTTGGCAAATTTGCCGCACACCCTTGATTGGAGCCTGC
ATCAATACTCTAAAGTTCTCATAATAACCACATTTTGAAAATTTGCAAATTTGCAAAAAT
TTGGAAATCGAGAAAGAAACGATTGACATACGATTGACGATTAACATGACATACATGTGT
TCTCATTTAAATAATTGTCACTGCTTTTCATGAAAGTATTGGAGATATACAATTCCAACA
AAAGAATACCTGAGTAAACCAATTAGTCACATAACTAATCAGCATAATATTTAAAATCGT
TCCCCACACCAAATAGGTAATCACTTTACAGAACTTTTCAAATGTATCGATTTGAGGCAC
TTTGTCTCCGAAACCAACTGTTGCAAAACTGATGAAGCTGAAATTTTTTTTAATTTAAAA
ACCATAATACTCTGAATATATCTATATAAACCTGAAATAGCAGTCATCAATGGAATACGC
AGCTCCCGAGTGTGGAATAAAGAAGAAGCCAATTGCAAATGTTAGAAGGTAGAGGCAGGC
GATTACGATACCTGGCATATCCTTGTCATTTACTAGTTCGCTTTCGGTTCTTTCCTAAAA
AGAGTTCCCATTGAGGAGTTGCCAAGTTAATAAGAAAATCTAACTGACCGAGAAAATCCA
ACCATGAGTTTTCCAGTAGAATTTTGTCAAATATTTTCCAAAATTTCCAAGGGTCACTAC
AAGAAGAGGAATCCCCAAAATTGAGAAGAATATTGAGAAAACTCGTGAAGCATGAGTCTG
AGGATACTGATTTCCGTAGCCTATTGTTGAAATTGTGATGAACTCGAAGAACACAACTTC
ATAGAAGGATTGCTCTCCGAGCACCGGATCAATGCTTTGAAAAATTGCAGCTCCAACCAA
CATTAATGTAGTGAGAATCAAGACGATTATGGCTTGTGGAGCGATTCGCCGGAGGAGTTT
CTGAATTATAATTGCCTGACATTGTGAGAAAAATTTAAAAAGAATCTCAGACGGGGAAAG
TTAATCTTCACAATAACTCAGTAGCAGAACTGGATATCACATCACCGATTCCTCGTGCGA
GAATTGAACTCGCAGCGGTTGAGTGGCGGGCGCACGCGCACACCACTCGGCCACAAATGC
AGTCGGCAGCGTGTCTCTAAAGACATATAAAAAGCGCGTATAGTGTAGTAATGTTACAAA
ATGGTTTGCAACTTTGAGGATTACTGTAGTTTTCAACTACTCGTTTTTTGCAAAGTTTTC
ATTGATTTTTTTATAGTTTTCGTTCCGTTTTTCATTAAAAACAGTTTTTCAACAAAACAC
GTAAGGAAAACTATTAAAAATAAATGAAAATTTGGCAAAAAAGAGTAGTTGGAAATTACA
GTAATCCTCAAAGGCGCACATCCTTTTGCATTTTTGCAAAATCATTTTCCTGTCGAGACC
TGGTACCGTATTTTTAGGAAAAACTCGCAAACTTTCTTGAGGTTTCCGAAAAATAAATTA
ATGCATCTTACCTCAAGACTGCTCTTCTGCTTCATTTTGATGAAAAATCGAGACAAAAAT
AGTGGAAAACAGCTGTGAAAAACCGGAAAATACTGTGCCAGATGTCGTCGGGCAGGTCAC
TTCAAAAACGGAAAATTGTAAAAAAAATCGATGAGTGATCGAAAAAGAAGAGAGACGTAA
AGAAGAGGTGTAAAAACAAACTGGCCCGTCTTTGTCAGTAGACGAAAAAGTATTCAAAGT
GCCCCATGAATTTACGACACTCGTTATAGCAACCAAATGTCTGCGCGTACCGCTCTTTTT
TTGTATATCACTCGAGAAGAAGAAGGAAAAGAGACAAAACTGTGTTTATTGTGGGGGAAA
AAAGAATGTGAAAAATGAGAAATGTGTCGACAAATTGATTTGATGTTTAGTTTCAGTGAG
AGAAAACGAACAAAAAAAAATATAAGAAGGATCTAGTTGAGGCAATCGGTGGATTCTCCG
GAGAATGATCCGGCCAAATTGAGCTCTCCGATATCGAATGTTCTATCGGCAGTCTCTCCC
TCGCTGATGAAGCTCTTTGGAATCTTGATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved