Caenorhabditis_elegans Locus Mono:14:C41C4.11
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:14:C41C4.11
Caenorhabditis_elegans
Mono:14:C41C4.11
II
C41C4.11
1001..1075
2075
CAAAAAATCCTAATTTTTCATGTTTTTGCCTGTAACTCCAAAACCCGGTGTCTGATCAA
AAATCTTTAAATCAAAAAATAAGTGCTTTTTCATTATGAACAGGTACTCAGTTGACCGTT
TTGTTATATCTCATGTGTGCGCAAAGATATGAATGGTAAAACAAAAGTTGCGGAAATTTC
TGAATAATTTCAAAAAACATCGGGAAAAAATTTCCGAAAATTTTTTTTGAAAGATAGCTC
CTAATGGTTTTCTGATTATGATAGCCTAATTGATAATACTGTGGGACTGTCATCTTGAAT
TCTTCTACTCAGTTGCAGCTCTTTGAAAAGTCAGAACTTTTTTGGGCTATATGTGTTGGT
GTCATCAGATATATAAATTGAATTTAAATAACTCACATTGAAGAGCTCCTTCCTTTTGAT
ACTCTCTGAGCATTTGCTTTGATTCTCGAGACATTTTTGACGATTTCAAGAATTCTTCGA
GTTGATCTAGAAGTTTTTATTAATTTTGCAATTTAAATGATTTCGAAAACTTCAGTACCT
TCATTTTCAACAATCGATTCAGATGATACAATGGTGAATAACAAGATAAGTTGTAGAAAT
AGGAAATTCCAACAAATCATTTTTTCAGACAATTCAATTAATTTTCAACTGATTTTTATA
ATATGTGAGCTCTATTGTCTTCTGTTTGCTCTATTGTTTTCAGATATGCTTCAAATTTTG
CTTACAGCTGTTTTTCGAATGAGCTCGTCTTGATTTTCTTTGTTTTCATAAGTTGTAAAA
CAAATAAACATTGCATTACAAAAAAAAATTGGTGAATGTGCACGTATACCATGTTGATCA
TGGTTCTTTCGGAAAGTCGACTTATTGCGGCCTATCGCCACCCCTATTCTTCCCTCGTCC
ATTTGCTACATATGTTTGCATTGATTCCATCATTCCGCCGTCTTGTGGCCGAATGGTTAG
CGTGAGTGTCTCTCGCTCTTACCTCAAAAGTTCGATACCGGGCAATGATGTCATACTCAA
ATCTGTCAGTCCTCAGACCATCCCTGGTGATAACACGGTTTTCCGGAGTGCTGAGCAGCC
CGTTTTACACTTTTCGAGTAAGAAAAGGTCCTAAATCTTTTTAATAACGATTTAAATCAA
TTTACGAGGGTATAGTTCAATTGTATTTAGTTTATGTTCATTTGATATAGATCTGTACTC
TTTTAAAGTTACCCGGTAGAGATTAAAATGGATTAATATTGAACTAACATTGAATGGAAA
CGTGGGTGTCTCATTCTCGCAGATTTTTTATTTCCCATTTTCATTGTTATTTCAATTTTC
CTGTAAAAATGTTGAAATGGTTTATAATTTCTTGTTGTCTATTAACTGCAATTTCATATT
CAACATACTACTTATTCACATCAAATTCTTGGATAAAAACAGTAAAAACGCATACTTATT
CTCGATTTTATCAACTTATAAAAGAAAATACAAAAACTCAATTAGATAGATTACAAGAAG
AAGCAAAACTTTCTGGAAAATCGTTAATACCACCATTTATCAATTTCGATAGAGAATATG
CTGTAAGATTTCTAGACAATGTTGAAAAATCTTTATAATTATTAAAACTTTCAGATAGCT
CCCAAATACAATATTTCAATTTGTCGTATCAAGAAATCAATGTCTACATTGATGTCAGGT
GTTGCATGTGTTCTTTATGATACTGGAAAATTTATGAGAAATAATCGAAGTATTCTCGAA
GTTTGGAGTCATCGTTTTTGTGGTGAAAAGAATGAATATCGAAGAATGAATGAAGTGAAA
TGGAGAATGGGTGATGCACATCATACATTTAAAAAGATTGTAGTCATTCGAGACCCAATT
GCTAGATTCATTTCATTTTTTTCAAACAAATGCATTTTGTAGGTTTCAGAAATATCCTTT
TTTTAAATAAAAGTTGAACAACGACAAGAACGTATCATTTTGATTGAAAAATATTGAACT
AAAGTTTCAGTATAATAAATAATGAATTGTTTTTCAGCGAAGCCCAAAAATACCCTGATC
GTAAGCAATGCTATAATTGTCAAGGAAATGTCACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved