Caenorhabditis_elegans Locus Mono:3:T19B4.8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:3:T19B4.8
Caenorhabditis_elegans
Mono:3:T19B4.8
I
T19B4.8
1001..1074
2074
GGGTGAGTGACAGGAGAAAATAAAAACAATTTCAGACTTAAGAAAAACTACATTTGAAA
AATTTATAATTTAAAGTAAAAGTAAGCCTGTCATATGCCTGCCTTCTTGCCAATTTAAAA
TACAGAAAATAGGCGGTAGGCAGGCAAGGTGTATCCATAAACTCTCAATGATACTAACCT
ATATTTTTTCAGGGCTTCAAGCCACTTCGAACAGAAGAAACTGTTGGATTTATCAGCGAT
GGATCAGAAAGTGATTAGCTGTGCCATAGGTTCCTATTTCAAGATTTGAACATTTAAATA
TAGTTTATTTTTGCTTTTATTTGTATATGTATATACTTATTTTCACTCACTTTTTCAAAA
GACTGTGGGTCTGGAAAGTTCTTCCAAAACATTTTTTCATCTAGAATTTTCCAAACTCAT
AGTTCTTCTCATTGTTTTCTTCTGGGTACTTCTCGTGTTCTTTTTCTTCATTATCTTTAA
TTTCATCAAAATTTTGTTTAAGGATTATCTATTTTCGGTTTTTTACTATCACTTCAAAAT
CGATAATTAGAATTTTTAATAACAAGCTTTTGGAAAATAATTGAAAAATATTCATAATTG
TTCTTATTCCCTGTCATAATCTAGTTTTCTGTCTATTTATGGTTGTGTTTTTGAGATTTC
TGAAATTTTCTTTGCATATCTTTTTTACCAATCTCGTCCTCTTTTCTTTTCGGTTGTGAC
AATCAATCTTTCCCTGATATGTCCTCTTTCAATTTTTCTGACAATCTATCTGCTTTTCTT
CATTCAAAACATTATGAAAATGAAGTTATTATCTGTTTCTCCATCTGTATTTCACAAAAT
ACAATTCAATATTGCTACTTTTCAATTCTTTCAAAAAATATCCAACAGTTGCTACATGCG
TCTTGTTGTCTAGCATCTATAGAAACTTTGCGACGGACGCGTTGCTGGCCGAGTGGTTGT
GCGCCCGGTCAGTGTGTTTGCTGTTGAGAGTTCAATCCCTCTGGCAATGATCGAATTATC
ATTGAGCCAATCCTTTTCTGAATTCTGTGAGGATGTAAATGATAGGTCTGAGCCAAATTT
TGTTTTCTAAAAGTTTTATTTAATGCAAGTTTGTTATTGAGATTAATGGGAAGCAAATTT
TCAATAAAATATATGTACATTTTCTAGGCAAGTATATACACAACAGGACTTTTTACCAAC
ACGCGTCATTTTTTTTAGTTAAACTAGAAATCCCGAAGAATTTGTTCAAATGCTCCACCT
TTTTTGCAATCAGCTAAAGTGGCTGTAAAGTGATTTCTCACCTGTTTGAATTAAAGTGTA
AAGTAGCCGGAAAGAGATGGGTGTTGACGTGCTTTTCCGCGCTCAAGACTGATTTACAGC
CTGTTCATTGTCTCTCTTACAACGTTCTGCTCACTATTTCCGCAAACATTTATCTTGTTC
CCCTCTCATGTTTCTTTATTTTATTTATTCATTCAATTGACAGATAACATGTCAATCGTC
ACTAATTAATTGGCGTTCCCTCTCAACACAATAGGCACAAAGTTTCTCACGATGAAGGTG
GAGGGCCAAGGACAAGTTGCAATGGATTACGGTAGTTACACACGTGTGCGTTGAGGCGGA
TTAAGAAAAGGTGTTGACAATAATCTAATTAGGTAAGAAAGATAATAATCTTATGGTTAT
ACTGAGATGGGTGGCGATAAATTAAATATCAAAACCATGGAAAACTGCTCATCGAGCTAA
ATTATTGAAGTTTTTTTTACTTCCTGAAAGCTTTCCCGAAAACGTATTTTTCTATTTTTA
AACGTATCAACAAATAAGTACAATATAAATCTTAAATTAAAAAAGACATCTCATACACAG
CGCCTCAGATCGGGAGAGAAGAGCTAAAAAAGTGGTTTTGGCGCGGGAGCGCGTTTGCTG
CAGACGTCGCACGAATTGGAATTAATGTATAGCAAAACAGTAAAATATCGCGTTTTTGCT
GGATTTTAGGGATTTTGAAGCATTTTTCAACATGCGGGACCGCCCAGAGACTGTTTGCGA
TGCGATTTACTTCCTTTTAACATAAATTTTTCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved