Caenorhabditis_elegans Locus Mono:36:F12F6.11
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:36:F12F6.11
Caenorhabditis_elegans
Mono:36:F12F6.11
IV
F12F6.11
1001..1072
2072
GGTCCAATGGGTCAACCTGGACCATCTGGATTGGATGGAGTATCTGGAAATCCTGGAGA
AAGAGGGCCAAAGGGACCACCAGGAGATAGAGGAGCTGATATTAAATTCTGTCCATGTCC
TCTAGAACTTGAGCTTTTGAAGGGAAAACACTCGAAATCAGTTCGTCCGTCACCACCAGC
GTCTCCTTCTTCAACATCTCAGCCGACTACATCTGCAACAACAACTTCCGAACCATTGTC
ACCTTCTACCACTATTGTAACAGATGCTCCAGAACTTGTTACAACTGAAACTTCAACAGA
AGATCTTGCGGTAATGGAAGATATCACTGCCACAACTACAATGGAAACTATAACCTTTGC
TTCACAAGACTTAGGAAAAGAAGAAATTCGAGAACCAGAAAATGTGTTTGGAAGAGCTCC
TGGAGCCGAAACGGGACCGCAAGGAGGGAATGAGATTGAAGTATTGAATTATGACGATGA
GGAAATTCGCACGGTAAATTGACTTCTTTTCGTAAAAAGACTGATCCTACGATCGGCATG
AGGCAGACAGGCATCGGACGCCTTTAGATGCTTGCAGGCGCGCCTAGTTGTACCTATGTG
GAAAGCCCTCAAATAAAAATTCACAATTTTAGATTGAACTTCCAAAAGAATATGAACATG
AAGAGACACGTGGCCCAATAATTACCGAAGAGGAGGACGATTATCCTGAAGAAACTACCA
CTACGTAAGTTCACATTTTTCCTGATTTAACCCAATTATTCTGAAAATTTCAGCCGACGA
TTCCGTTATGTCACGAAGCGTCCAATTCGATTTGAATAATTCAAATTAAGTTGCTTTTTT
TTCAATAAAATACATTTATTTACCATTCTTTCATCGCCCTCCATCTTTTCTCTCACAGCA
AACATGTATAGCATTTTATTGGGTCACAACTGTTGATTGCATGGCCGACTGGTTAACGCA
GTTGTCTGCTATTTATGCATCACGGGTTCGATTCTCGTGGCGGATTGAAGATGAAATCAA
CGACGCTGACCGGTAGTGATGTGTTGTCGAAACCTCTAAGAAGTACTGACCGCTTTTTTG
AAATTTGATTTTGGATCCTCAATTTTTTTTTAATTTGCTGATTCTCGTTCTAGGTTGAAG
TTTGGCACTTAGTTCTCTCAATTTTTGAAGGTGTTCATATAAATAATGTAAGGATGTTTT
ATTCGTTGAATGAAACATTTTCCTCTACTCAACATCAATCATTTCTTCATCTACTCACGG
CATGCTTTATTTTGGAGACATTGAATATTTCTGGAAATTTCAAGAAGACATAGTTTTCCT
CGTTGTCAGTGTAGTGTTTTGAATAATTAAAATGCAGAACATAGGCGGACCCTTCCATGT
TTAACAATGATTTTCACTTCAAATGTTTGGAAAATAAGTAGTCAGTTTTAGGTAGTTCTT
AAACAGGCCCTTGTTGCTTCACTTTAACACCGTTTATATCGGTTATCTGTTATTTTATCA
AAACTTTTTAAATTGTGAAAATTTGTGTACAATATATTGGTATACTTTCAGAGTTGAGCA
ATTCACACTTAATATATGAGCTGTCAAAGTAGATCACTGTGGGTGCAAGCCTAATACACA
AGACAAGAACTATAAGCTAACCTTACAAACGTTTTAAGTTGGCAAACCGAAACCTTCCAC
TATTTGGTCTAAAATATTTCTCAACTAAATTAATTCAGATTTTCTTAGTTTCGACACCTC
TCCGTCCACTGGAAGGACCAATTCGACATCATAAGATTGGCACCGACAAGTGTGTAAGTT
CTTTTGTAATGGAAAACCGATATTCTTGTACTTTTTGAAATTCGCGTGCTCCATAAATAA
CTTTGCTCTCTATGTTGCTCTGCCAATACGTGATAGGCCTATTAAGGGGTGCCCTCTCTT
TTTCCCCGTCATCTTCATCATACATGTTTGTCCACTCATTCTTCGTCTTTCTTCTCACTC
ATTCATTTCTACATGATACGTCTTCCCCTTTTTCTCCATTTATTCGTCCCTTCAAGCGTT
TTTCCTTTTCTTCAACTATTTAGCATCATCACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved