Caenorhabditis_elegans Locus Poly:C27H5.10
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Poly:C27H5.10
Caenorhabditis_elegans
Poly:C27H5.10
II
C27H5.9
4133..4201
5201
aataagcaaatttttctgaatgttctctatctctgtactatgacagttttcgatccact
tttagagttccaggttctccaggtgctccaaaaaatttgacagtttttcccaaactaggt
ggaaaacttcgaattgttttttcgggtttagaaatcgagatattttgaattggtcgaccc
accttccaacaagcctcattatactaacaccttttcagtgggagtttccgttaaaaaaaa
actccaatttgggcttacacgattaatctagttttgtctggattgtgactgatatgtggt
gctctatttcttttaaaacattcagcccccacttgtaacatttctgaaaaagatcctttg
aaggatcttttaattagaagttaaaaacaaaactaccagggatgttcatactgtgtatga
ggtctgtacctccagcttcgactctttcatttttgtcagcattctaaataacagaggaaa
caaagcacattaaaaatactgtttattccatttttatgaaacttagtcacactattttcc
aggaatctgggatactacgtctgtgagaatctttaaccgttgagttcaaaaatatgtagt
ccaatcacctcaggctccacccaacacgtgttgacagaaggatgctgttgttcaagataa
acatattcgcttgaattctctcattctgcaaggtggcatggaagtttgtgtcacgaagca
aagaatagacttgggtttccctttctaataaattaactgatgtaaaattctagtatcaaa
agccatataagtgtacacctagccgatcaccaatgttctaaaattctaaaatagatccaa
gaattttctatccttcaaaccacaaatgctttagccattattctaaagatttaattaaaa
cgtgctgagcacatggtgcctgacccgtgcctaaaccgcccagcaactcatcctttgttt
catcgtcacaatcttcgtcatccagtactccaaaagtagtcATGATTTTTCAGAGGATGT
TCCCAGGTGATGGAGAAATACTTCTTCGCAGTCGACTTTATATTATATGTGGAATACTTG
TACTTATTCCGAACACTATTTGTCTGGTTGTCTTTAATTCCAGTAAGGATTTTAGACAGA
GATTCGTGTTTTTCACTTTATTGTCACTTTCGGATATGgtaagtaaacttggttttattt
gcatatacaacatttttcagATAAATGGAATTTCATTCATAATGTCGGGCGCAGGAAGAT
TGGATCTATTGTTAAGAGATCAATATCATATTGACACAAGTAGTTCACAATGCATGACTG
CATACTTGTGGCCAGTATTCTTATTATTCGGTGGTCAACTACCTGCAACATTTCACTGTT
TGTTAACTGTAGAACGAGTGCTTGCCGTGAACAGAGTGAGCTGGTATCGGAGCCGTTGGA
CATGGAGAAACAGACTTTATCTGTCATCATTTGGAATTGTTCTCTGTGGAgtgagttttt
gtaacaagatgttcaatgaaattgtggggtggtactgtagatctaataaaatggttaact
ttaaaaaataaaggccatgttgtgttcaacttgctgaatttatcaaaaggctccaattta
ggaaagacaactttttcaggaacggacagtcacaattttctgatgaaataaaagttaata
tatctgtagagacaccataatattcactgtataactccttgctgaccaaaccaaactatt
ccagCTCCTCACATTCATTGCATTTGTTGTGTCCTTTGCTTCTCCTTCAATAAACGATGA
TCGAATGTGTGCAGTAATGAATTCAACTGGAATTGTATATGGAACTATTCATTATTGCTG
GATTGCATGCTCGTACATGATAGCTTTTGCAGTTACACTCAACTTATTTCTACGATCCCA
CGGCTCCAAAgttcgttgttttcgctagaatttagtcacaaaaagtctaacgattaaacc
gcgtttataaaaacattgtcatttcagTTCTTGAATCACACAGAGAAACGGAAACAAATG
GCTATTCTAATTTTATCCGGTATTAATGTATTGATGGTCAGTGTGCCTAATTTTGTGCTG
GTTGCTGATCAGTGGCACTCCGATGAGTTCGACGTACTTCTTGTTGgttagtgaaccttt
ttatgcaaaatgcttcactgattgtgtagtcgtaaaaacttgtgtcgagcatgttttaaa
gtttgaacttcaatgggaatatagttgaagtcatggtttgaatatttgccattaattgag
ccaattgatgaaaagaaagttcattttttgatattttagatattctaagatattttcaaa
agtctgacaagacttggtcaagactgttctagttcaaccaatttaactagttcaactctt
gtcaaagccttgaccaaaatgaactgtcaaacactaaaattgaagtctgaaataacattt
caatatcactttgaataatgagataataacatataaactagaaagaaaagctagttaatt
cttaattaacttaagaattaattaagaattaactttaaattatttttttcaaatagttaa
tgtttccagGTGTTGCCTATCTTCTCTATGGTTTCCAATCTTGTTTCAACCTTCCCATCT
TTTACTTTTTCCGTCTCGAATTCCGTCGCCGGTGCCACGAACTTCTCCGTTTCCGTCGTA
ACGGGACAAACACAATTGTGgtaagattgatgcatgtcctttcatttttcaattattttc
agttcttcctatttttcagTCGAACGACATGAGTCGCCAGAAGCTATCACGTGTCAATGC
TTCATTTGTGAACACTGCAATCTAAatgtatttttgggacaattttcctgagctattcaa
tttgtaaaatatattcatatgtacatagatgaataaataaatccgttgaagattttcatt
ctgaaattgaatattaaaattaggtatgtattgttttaggaattaaaaaagagagatcca
tggagaaacagggaaggattagaagggaaaaatggatatgaatgtatatgtattagtcgt
aataaagacggactcgagacgtgcttacaagaagatctccatcatagaataaagtctcga
cgacgacgtttccgctgaaaaattgagattgtattttcaatcgttcgaaatgtcaaggcc
tcgaacacaatttaatgttatttttatagtaggattaagtagttatatataagatggtgt
gcagcatctcctgtggtacgaaaattacataccataaagaatactaaaacgtttcaaaac
tcaaaaaaaaaactatcggtaattactcagttttcaccagtacaaatattgaaagtctgt
tttaatttttataaaaaacactgtattggtaaaatcctacagcaatgtttgaaattactc
aaaaacccaatttttgaatttttgccaatttaccaaaacgctgactgatataaaaaatgt
ttgattacgatactcggtcatgtttacctaataactattaaggtttgcatgtttctgttt
ctagtatcttgaagtgaagctttgaagcttagaaatctagtacttttgcacttgttttac
ttacctgagtacagatggtgggaacatttgtgattctggagctgcctcaatcatattttg
ccacgtgtttgttgaatcaggaatgacaaatccaaaatcgaaataccactctgaagtcgg
aatacataattagttttcatcaccagaagccaatattattcatccattgcgtgcaataac
ataatgaatattcgagtgattctatcttaccttcaatgatggttcccttcaaataaacgc
gttgcTCGAGTCGAAATTTTTCGATTTTGACTGATGAAGTGAAGTTGATCTCACGAGACA
CCGTACGACATTTTAGAAGATTCTTTGGCACGTGTGCTGCAATCCATTAGTTTTTATTTG
TTGGCTTCAAGCAATTCTATTTTTGTAGGAAAAACGCATTGCATTAGAGACCAGCGGTAA
AAGACATGTGAAGGCTTAACTACACGCTCAGTGTTGCTTGCTAGCTGTGGCAGAATGGCG
CAGTGGATGTGCGCGCGCATTGGGGGGAGACGCTCTCGCGTTCGTTCCCTCGTGTTGTCA
GTGACGATATTACTTACCGCCCCAGGCATAGTGTTTGTGATGATTGGTTTATTCCGAGAC
TTTTTTTGAAATTCTTATTACCTTTGTGTTCCCTTTTTGGGTCAGCCATGTCTTCTGTGC
TCTGCCAGAGAACTTTTCCAGTTTCTGCATCACGCAAGTTCATCCAGTTGAGCTTGAAGC
CAGCCAGAATGCTCTCTGCCTTTTCGCTCAATTTAGAATCTTGATGACGAGTAGCGGTAG
TGGCCATGACTGGAGCTCTACTCTCTGAAGAAAGTGATGTTTTGAGGAAATGACGACAGA
CCGAGGCACAAGAAAGAGGAACCGGTCATCTTAGGAACAAGGAAAAGTCAATATTGACGA
AAAGTGACGATTGCCGGAAAAAGAGCATAAAAAATGAGTGTTCCCGAAGAGTGGTCATTA
TGAAAAAAAGAACACGTGGAGATCATTGAATTCATAAAGGAAGTCGTGTTATAAGTGGCA
CTTACATTTTATGAAAAAGGGAAGAGAATAAGAGAAGTAACTCGTATTCATACAATTATA
TATTACTGCTTATATATTTCTTTTCGTAATTCGACGGTTCTGTGGTTTGAGCAGGATGGG
ATTAGGTGATAATTTAGAGAAATATCATATTATTTCAATAATTCCCTAGATAAAGCTATG
ACTAGTAAGTCGGGCACTTATAACGCAGAAATTGCAATAGAAAATTTTCTTCAGAAAATC
TACATAAATAGTCGATTGTAGTGTTTAAACAGAAAATGTATTTTTAAAAAAATATTATTT
GAACTTATTTGTAATTCTGAAAATTTTGTATCGTTTAGATAACCTACAAATTGAAAGTAG
GAATTGAAACAAACAGAACAAAAAAATATGTGCAAATTTTTGCATGTAATTAAAATTTCC
AAACAATTTTGGTGTGTATGAAAGAAAGCAAATAAATAAATTTAAAAAGTCGACCAAAAC
ATATTCAATTTCAAGAGGCAAGACGAGGTGAGATGATGTGATAGAAAAGGCGTGAAAAAG
TTTTTACGAAATTTTAGAGGAAGCGCAGTCTCTGGCACAATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1177, 1220..1489, 1744..1929, 2007..2145, 2589..2719, 2779..2844
1001..1177, 1220..1489, 1744..1929, 2007..2145, 2589..2719, 2779..2844
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved