Caenorhabditis_elegans Locus Mono:44:C53B7.8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:44:C53B7.8
Caenorhabditis_elegans
Mono:44:C53B7.8
X
C53B7.8
1001..1071
2071
TTGACGATACTCCTTCTTTAAGTAGGCCCCTCCAAAAAATGTAGCGGCAGAGGAGCACT
TTGAACTGGAAAAAAGTCGCTCTGAAAATTTTTCTCTGCGTCCTCTCATTTTCCAATGCT
ATTTCGCACGTCCCTATATATTTAAGTAGATATCAAAGTGTCACGTTTTCTGGTTTTTGT
CATTTATTTCATTTACAAAAAAAGTGTCATCGAATGACCGAGTGGTTAGCGAGTTTGATT
AATATTTCTTAAGTCTGGGGTTCGACTCCGGGTGCCGATTTTTTCCAAAATTTGTTTTTG
CAACTCCGAAAAATCTCAAAAATTTTTTCATTGTGTAAAAACACCCAATTTTGATATTAA
ATAACTTTGACAACTTTTCTGAATTTAAAAAAAAAATTATATTCACTGAAAAATTTTGTC
ATGGACTTATTCAAAAAATTTCAGATTTTTTCGAAAAGTTTAAAAAATTCCAAAAAAATT
CCGAGTGCTCTCCGGCCCCTGAGCATCCTAGAAATTATCAAAAATCTACAAAAATTCACA
TTTGGAGCCATTCTACGGGCCTTGAAAGTTGTGAAAAAATGCACTGAAAAGTTTTCAGAG
CGATATTTTGCCAGGTCAAAGTGCTCCTCTGCCGCTAATTGTTTTGTAGGGACCTACTTA
AAGAGTCTTCTTCGAAATGACATAGGTTTCATTCAGAAGTCCGGGATTAAGTTGAAATAC
TTCCCTTGTCAGATGTAATTCTGTACTTGATACTTGGAAAGTATAGATCTAGCGGTTTTC
TGTAATGAAACATCATTTATTCATTGGTATAGGTATTTACAAAAATTACAGTTACCCAAC
CTTTCAAAAAACTGCTTAATATCCTTTAATTGAAATTTTCAAGGGACTACTGAAGTGTCG
AAGAATATGAACAAAAGGTTCGCATTATAAACTCTTGACACTGGTGGCCTTGCGGTTAGC
GCGTTCGATTAGCGTGCCGGCACCCACTGGTTCAATTCCCTGTGTATGACGACAACATGT
TAGGGACATCTGCACAAACCGTGAAGATTTAACGAAAGTAGTACTGACACAGTGTCTTTC
CTTTTTTCATAAACGTTATTGAAAATAAAACTATAGAAAACACATTAATAGACAGTAGAA
TATGTATTGGTTAAGAAAAGTTATTCTAGTTTCGCTTCGCTCTCCGAGAATTAGTTTTCC
CCGATCAAACTCCGCTCTAAAATGTTAAACTCGCGTTATATGGTATTACGGGTTTATTGT
TTGGGATTTAGTGTGGTATAGGACGTGATAAATGTGATAAATAATGGGGATTTGGGCGCG
TGGCGCCCAAATTAGAATTTGATAAACGGGCCTCGAAGATTTCAAAACGGGTAATTAATA
TATCCGAGTAGTATCGTAGACGGTCCGATCGTTCCTCGTATGGTGTGTTCCTCGTATTGT
ACGGCCTGAGTCCGCTCGGCGATGGCACATGGTGACTGATCGATGGTGTCTGACGTGGGG
GAAAACTGAAAACTATGAACCGAATTACTGTGTCTATTAAATAATTTAACGGTTCTTAAT
ATTTTATGTAAACAACTTCCCTGCTACCGTCAGCACTGCAACGAATAGGCTTCGTCGTTT
ACGGACCGAGCGGTTTCGAGCAATGTTCCTAAAACTTCGTCTTTTCTTCTCTTCCATGGG
TCCGGAGAAACGATGTCATCTCGGCGTCCCGACTTGCTCGAGGGTGCTCTTCACTCCAAC
GAATGGGCACTTCTCTGTCAAGAACTCTGGGGCTTCGGCCTGTGATCTGCCTCGTTGACT
CTGTTGACTGTCGGCTGAAGCAATATAATACATAATCTGAAATGACACATTACATTAATT
TGAAAAATAGATGGCCATTTCACAATTGGTCTGCAGGGACCTCTAAATCATCTCGATTTT
CTTAGAATAAACTGTAATCGACTTACTTGAGCCCGTGTTCAGACTGGTATTGATTTATGA
GTCAATTATGAAAAATTAATGCATATTATAAAATTTTCTCGTAAATTACTGGGGTTTTGA
TATTTCTACCACAAACCTCTACCGGGCAATTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved