Caenorhabditis_elegans Locus Mono:0:Y74C9A.6
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:0:Y74C9A.6
Caenorhabditis_elegans
Mono:0:Y74C9A.6
I
Y74C9A.6
1001..1163
2163
TCGTTAGTGAATCGACATGCATAAAAAACGCCAAATTCCGAAATATTTAATATTTAAAA
TTAAAATTCATTTAAAATTGTTGTTTCGTCTCGAAATTTAGAAAATATATTCTGAAAAAG
GACATATTTCTTTTATTTTGCCAAAAATTTCAATGTTTTCACCCAGACTCGAAATTTCGC
GATATTCGGGTCAAAAATACTGTAATTGGGGTCTCGACACGACACGTTTTTGCGAAATTC
GAGCAGGCGTGCACCTTTAAAGAATACTGTAATTTCAAACTATTGTCTCATAGTTTTTTG
TTGAAAAGTGATTTATTTAAAGAGAAAAACTATGAAAAATATATGAAAATTCCACAGAAA
TGAAGTTTTTAAACTACAGTACTTCTTAAAGACACACGCCCGTTTGTATTTCACAAAAAT
TGTCGTGTCGAGACCCCACTTACTGTAATTTTAGCGCGAAAATCGCAAAACGTCACGTTT
GGATAATATCGAAGACAATTTGCACGAAAACAATTTTTTACTAAACATTTTTTAAAACAA
TTCATTATTCAGCCCGAGCTTCTTAAAGCGTTCGCCGATTCTCAACTGGACATGGTCTCG
AAAGCACTGCAAACCGGATTCCCAAAGGAGATTTATCCAGTAAAAATGTATGCATTGAAG
CCTCAACACACCGGATTCACCAATAATTGATTTAAATATCGATTTTTATTCGTTTAATTG
CAATTTTCCCGAAAATTTCATGTTTTACATGCGTGCTCACGTTATTTCTGTTAAATAAAT
GTTAAGCAATATTTTAGATGATATTCTGTTGAAAATTTTATTCAAAATTGGTCAATAATC
GCTGAAAAGCGCTGAAAAATGACCAAAAACAAAGATTCCCCCACAAAAAGTTACCACCGG
TGGGCGGAGTCGCGGCGCACACAACAGACAGCGATCGACGGAACCCGGGAGGTGTCGGTC
GCCGCGGTAATACCGGTCGCCAACCGCCGCAGTTGAAAATTAGACAGAGGAGTTGATGAG
AACTCTAATCCATTCTCTGAGCGAGAAGGATGGCCGAAGCGGGTTCGCATTTGAGGCATT
AAGGTAGACGACAGAGTTCTTCTGGAAACTACTGCCTCGCGCTGACGTCATGCCTTCGCG
GGCTGAATTTTGGGTCTGATCCTCTATTTTACAAATACTAAAAGAAGTCTATAATATGTC
AATAATCGAGTTATTCCTAGTAGATAGATCGTTTGTCGAATATATCCTCGGGTGGTTGTT
AAAGGGGGAGTAGAGTTTGTGGGGAAATATATGTTTCTGACTCTAATTTTGCCCCTGATA
CCGAATATCGATGTGACAAAATTTAAAAAAATTTCCCTGATTTTATATTAATTTTGAAAA
TCCGAAAATCCATTGGATGCCTATATGTGAGTTTTCAAACGCAAAATTTTCCCGCCAGAG
ACGCCCCGCCCACGAAACCGTGCCGCACTTGCGGGTTTACGAGCTGAATATTTTCCTTCT
ATTTTTATTTGATTTTATACCGATTTTCGTCGATTTTTCTCATTTTTTCTCTTTTTTTTT
GGTGTTTTTTATTGAAAATTTTGTGATTTTCGTAAATTTATTCCTATTTATTAATAAAAA
CAAAAACAATTCCATTAAATATCCCATTTTCAGCGCAAAATCGACTGGAGACGAGGAAAA
TCGCGGCGAAACGACGTTTCCTGGAAAAGTGAGAATTTCTTATGGCAAATATTATTTAAA
AACAATCAAAATATAAAAAATAGTTCGTTCGCTGAAAATTTAAGCGTAGAACATCAAAAA
AATCAGCGGCATGACGAAGTTGTCGGCAAATTTCTATCTTCATCCTCATCCTCATCTGTA
ATGTCCTCTATTTTTTCCCGACTATTTTCCGACCAAAATCAGCCCCTAGAGCGTCTATCC
AAAGTTGGCGTTCCTCTTCTTTTGTCGGTATTCGGGTTACTTTCGTGGATGACTGTAGCA
TGTCGCAGAATTGACATCGTTTATATTGGGACATCCAGAAAACTATCATAAAATTATATT
TTTGTATCAGTTAGTTTTTTTCAATATACTTCACACAGTTCAGAACCAGCTTAATTGTGA
AATGTTTTAATGTCTTACTGCGAAAATTTTATTACTTAAAAGTTATCAAATCTCAATAGC
GAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved