Caenorhabditis_elegans Locus Mono:32:C55F2.3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:32:C55F2.3
Caenorhabditis_elegans
Mono:32:C55F2.3
IV
C55F2.3
1001..1083
2083
CAAAACTCTCAAGAGAGCAATTTCCACTTTTTAAAAACAGGAACAGAAAAACGTGGTAA
AGTAACAAAAATAGGAAAATAGAAAAAAAGGCTTTAACACGAAAAAACTTATGACGTCGC
CGTCCACCCAGTTTTGGATCATTTATAAAGAGTTGGTGTTCTCTTGAGATATTTCTTTCT
TTTTTTAACCAAAAAGTGGGTTGGTAAGGGTCTTCGACGACAAATGGCTCCCTCAAGGAA
CTTGCGGAGCGTGTCAAAATATTTCATTCATTCTTTTAGCTTCATCTCCCTTTTTTTGGC
TTTTCGGGTTAAAAAGAGAATACAAGAAAAGCGTGGTGATAAGTTATATGAAGGATCCTT
GTTTTTATTTGTGGATTGCTGTGATCAAGAAGCTTTAACATCGTTTGAAGAACGAATCGA
TGAACAAGGAAATGTCTGTGCTCATTTTAGAGCCTACGTAATGTGCATTTAAAAAATGTA
GTGACAGAAAATCACAATTAACTTGAAAAAAATAGTTCTGAAATTTGTTTAGTTAGGGAT
GTCAAACCGGAATTAATAGGACGTCCAGCATTCGCTTTTACTAATACTGGACGAGCAGGT
ACTATTTTTTCGGCGTTGCAATTAAATTTTTTTCTTTTCAAAAACCAGATTGCATGACTT
TGGCTTATTGCAATAAATGAACATAGTTTTTGTTTTAAAATTCGTAAAGTTTGGAGCGAG
AAGTGAAATCTGAACGTTTTTCACCACATCCAAGGTTTTCCAGTTGTTCTCAAAATCATG
AAACTTTTTGGAAACATCCGAAATTGTTATCTGGTTCCGAATAATCTCTAAACAAGTAAA
TTTTTGGCTCAAAATATGTTCAATAAAATTAAAAAACTGGCAAGTGAACTGTAGAAAAAA
AATCATATAAATATCTGATAACAATGTTTAATCATTGTAATTTAGTAGCTTAGTATTATT
TCCCACATATTTATTTACTGGCCTTATTGAAGCTTTCATCGGTTGTGATGATTTATTAAC
CATCTAAAACTAACCTCCGAAATGATATGATCGTAGTCAGCAGGATCACAGATCACACTG
ACACGTTCGTGATTCTTGGCAGCTGCTCGAAGAAGCGTGACTCCTCCTGAAATTGAGAAT
GTAGTTGAAATCGAACGTTTCATTCTCTTTTATAGCTACAATGAAAATGGACCCACGGGG
ACAATTGAAGGTTTATAGATTTACTCTCTGATGTCCTACTGTACAATTAATAATAAAACC
GGACACAACAACATTTTAAGAATATGAGTTTATATTGTGATATAGATTCTAGAAAAAATC
TGGGCGGGTTTTACATACCCGGAAAAACAGGAAAAAAGGTGAAAGATTCATGAAACAAAA
GCCCTTTTAATGGGATAAAAATGTAGGAAACGGTTGGAAAAACAAATACAATGGGTACAA
TTGAACGAATATTTCCACTTTTTTGTACTTTGTGCTAAGATCATAAAATGTCTATAACCT
TATCCTTTTTTTAATATTAAAAAAACCATTCGATTAGAAGTTATAATATGGAAATTTCAA
TGATACCAAAAACTAGAGCTCAAGCTTTACGAAATGATGCATTCGTAAGATTTGCTCCTT
TAAATGTTTCTGAAAGAATTTTCTGAAGATGATCACAGATTATATGAACTTATTGAGAGG
AAGTATAGAATGAAAGTGTAAACGAATTATTATTTTCTCAGTTTTTTGTTGGTTGTATTG
TCTTTTTTTGTGAATTCTCCAGCTTCCGTGTTAATTGAATTTATATTTTGAGGAACTAAA
AAAGACGAACAAGAAGAAAATATAATTGTTTTGGTGTCAGAAAGGATTTAGGAAGGGAGA
AGAACAATACATACATGTTTTCACAGTGATAAGTAGAGAACGATTTTTCAGAACCTGAAC
GTGCCCAATTTCACGAAATTGATATTTCAATTAGCTCAAATAAAACTACTTGATCATAGT
ATTGTATGTGATAATATTGCCAATTATTAAATCATTCACTAATGCTAAAATGACGAATTA
CATAACATAGTAAAACTTATCAAAAATCTTGAATTTTTATTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved