Caenorhabditis_elegans Locus Mono:33:H09I01.2
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:33:H09I01.2
Caenorhabditis_elegans
Mono:33:H09I01.2
IV
H09I01.2
1001..1072
2072
GCCGTTTGGAAAAATCATTGCATAGACCCAAAAATGTGCAAACTCAAATAATTCAAACA
TATTTTAGGTGTAAAACGCGAAGAATTGTTAATTTAAAAAATCATGATAAAAAACTGAGT
AATTCCAACTTTTTGACTGTTATCAAAAAATGTTCAAAAATGTTTGAAAGGTTTTTGGTA
ATAATGATAATTGGTAATCATATTTGGCTTAAATTTTTCCAGTTACAAAGTTATCATAAA
ATGGAACATTTTGAATCACACATCTTCCAATAAGGAATCTCATATCTTGCAACGATCTCA
GGTGTACGGTGGATTACGGTTGGCACAGTGAGATGCCAACGCTGTCATTGGATGTTTAGT
TCACAATTTTAATTTTGCTTATAATTGAGTTAAAAAACTGAGAAAGATAAAACAATTGAA
AATAATTTTCAAAAGCAGCATTGGCTGGGTAAGAAAACCAAAATTTACATGCGAAAAATG
TTTCAAATATTCCCATCGTTTCACGCCATCGATGCTATAAATTAAGTATAGCTTAATTAA
ATTCGAGAATCCAGTAAGTTTTTTTTTGTTAAGTGCAGAAAAAGTAACTTTGAAATTGAA
CTTTTTTATCAAGAAGCATTTCCGGAAATACGAAAAACAGAATAAAAATTGTGAAACGAA
ACTGATTGAAATATACTATTTACATATAACCAGAACAATTTTTTTTGGCTGAAATTTATC
AAGGAAGTAATTTTTCCAACTAAAATTGACAGCTAACATTTTTAGTTGATGTTCTCTGTA
AATACTTTAATAAAAATTATTAATAAAATTCCATACTTGGTCACGTACTTATCATATTTT
GTAGCTTTTCGCACAGAAATTCCAAATTTCGATCATATTTCCGATACTGCGCCACACAAA
TGTTATAAACGCATTGAAGAAGACTCTCCAAATGACGCACGTGGTGTCGCGGTAGTGTGT
TTGGCTCTCGTCCAACAGGCCGCTGGTTTGATGCCCGCTGACTGCGGTGACGATCAACTC
TTACCTACTATGACAAAAACAATGGTTAGACGTTACTCGTACTGTCTGAGCAGTTTTGTT
TTTTTTTTCGAAAAAAAGTTTACATTTTGCCATATTTACATAAATATTCCATTAGTATTT
AACCACAATGCTCTATAAGTTCAATAGAAGTTAAGCTTTCCTAGGAAAGTGTGACTTTTA
AATTAATAAAGTTTTGAAAACATATTCATGTTGATGGTTTAAGAGTTTCGAAGAGATGAC
AAATAACTTTGGAGCAGGAGAAGGTCTAAAAAATCAATTTAGAAAATCGTCAAGTAAAAT
CGAAAATGTGTGGACATTAAACAGTTGACTGCACTTGACTGTTTTCTAACATCATTCTTG
TGTTTCGGCAACTACAGTACATCTTTTCATCTTTAAATCGTAGTATGAACTTAACAAGAG
TAAAAGTTGCACGTTTTATTTGTTGATCGACCGAGAAGCTCGGCGAGCCCTACCAAACAT
TGTATATGATTTGCGAGAAACATGTTTGGGAAAAGAAGGATTGATGTGTGGTCAGTGAAA
TTGATCTAAAAACTAAAATCAAGGGATCACTTGTGCGCGGGGGAGGTTTCAACAATAAAA
CAACAATTGTGGGGGAAAATCCGGAATAATAAGGCACCGGAAGTATTATATTTTTCTTAA
TTACAATTATCTTTGATTTTTATCGAAAAACAATTTTCTGTTTCAAACAAGAAATGTACT
CACTCCCGACATAAAAATAATATTTTGAAATGGTGATTTTATAAAAGTTTGGGACCTTTA
AGTAGTACAATAAAACGTTTTTACCGTTAACTCGCAATGTAATTTGGCTTTTCTATGTTT
CTCGTAATTTACCCAAGTTTATGATTTTTTTTACAATTTACATGTGTTTCAATGTTTAAA
AAAAGTAAAATTTTTAAGAGAAAGCATGTGAAAATAGAAGAATATTGCAAAATGACGAGG
AATGGACACTGTACTACTTAAAGGTGCATACCATTTTTACCGTATTTTTGAAAATCATCT
CGCAACTGGGTATAACTTTCCAGTATTCAAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved