Caenorhabditis_elegans Locus Mono:38:C16D9.10
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:38:C16D9.10
Caenorhabditis_elegans
Mono:38:C16D9.10
V
C16D9.10
1001..1074
2074
ACTCAAATGCCACGTTGTGTCCGGATGATATCTATGAGGATGTTGGAATTGCAAGGTTG
GTTATTCTGAATTTTCAAGTAGATATTTGTTGGCTGAAATTAAAAATTACTTTTGCATGT
CTTGAAAAATTTGTATCCCATCGCTTATACCCCGCCCACAAAATGGTCCTAACTGATAAC
CAAAACACAAACGTAAAAAATTGAATCAATACAAATAGATTACATCCCTCCAGACATGTT
AACTAACACATTTTGTCCTACAACAAGAAGCTGGTTACACAATAGATGTACTCAATGTTT
GATGAATAACATTGCTTGTTTGACATTGAAATTCATTTTGTCAAATTTGAAATAAAAATT
GTTTCAGATGTCTTGCAAATGCAGGAATGTATCCAGAAGATACTCGAAACTCTCTCGGAC
AGAATCGGTTCAACACATTCTCGCCTTCGGATACATTCCATCAAACAAAAGCTGGCATTG
ATTGGGTCAAATTCAAAGAAAATAAAGTTTGTTAATTTTATACTAGAGCCCCATAAATTT
CAAATATTTTCAGGGTTATGAAGCATTTGCCAATGATCTAATCTCATTTCACAAGCTTTC
ACCGGATGAAATCCGACTTTTCGATATTCTTCTTTATAGAACAAATAGGAAAAACGAATA
GACATCAGCATCAATTTTCGGACTTTAGCCCCCAATCAATTTCCGTGATTTCCTGTGATT
ATCCCATTTGTATCTGTGGCACTTCATGTTCATGTTTTTCGATTCCAATCCATTTCGAAT
CTCGCCAAGTTTATTTTGTTACGGGTTTCTCAACTCATATCAATTTCTTTTAAATAAATT
ATTTTTCCGTCTCTCCGCTTGTCAACGAATACCGCAGAGTTCTCTACAATGCGATCACTC
CCAAGCTCCTCCTCTTTCCCTTTCAAACGACAGCGGTCGGCGGAACTCGCAGCATGTCGG
CCGCGGGTGTTTAACAGGACGCTTCCTACTCATCGAAGGCTGGGAATGATGACCTTCTGT
GTAGGAATCTCAATGAGTGACTGTGACATAAAAATGCAGTAAATTCACTGACCCCAATTT
TTGAAAGCTTTTCAATAAGTTTCATTTGGGCTGCTTATACTTTCTTGGAACTGTAGAAGA
GTATAATGAACACAACAACATTTTGCTTTAAAAACAGGTATTGTAACTCGTAGATTGGGC
AACATTGTTTAATTTTTCGGCAGCCCAGAATAACTTGATTTCGACTGATTGCGACGTCTA
TATTGTGCATATGAAAAAGTACATTTTCAAAAACATTGCTTTAAATTCAAGTCAATCAGT
CAACGTTTTACATACTCAATAAAAATATAGATTTTAAACCCAAATTGATGAATCGCATTT
AAAAATGGAAAAAAGAATTCCGTCGAGCCGGATTCGAACCAGCGACCTAAGGATACCCAC
TGACTCTACAGTCCTCCGCTCTACCAACTGAGCTATCGACGGCATGTCGGCGCATGTTCC
GGAGGGCAATTTGAATTGTGGCAGAAGCTGGTGACACTGTTATAAAGAAAACGTGTTTCT
TCGATAATCTGTATAGGTCCTATCAAAAGGTTTTCAAGACACTTCAAATATTTGTATATG
ATTTTCTATTGACAATTTTATGAATTGGTATTTTGGAATAAATTGTAAGGCATTCAAAAA
AAAACTTCCATGGTTTACAACCATAAACCCGGAAATATGATTCCGATCTGTTGTAATCTT
GCAGTTTCGAATTGAGTTTGTCTTGTATTTATTCAGCTTTTAAATCCTTATTTCAAACAA
AGGCCTCCTTTCCGGTGAATTGCATATTAGTATCTCATTTTTCCCCGCAAATTCTCAATA
TCATATCCAATTGTAACAACTGCACAAACAAATGATCCATCAACAATTAAAAACTGAATT
TGACTGTGAGTAGGTGGAGGAAAAGGAATATTTTTGAATAGACCATTTATTTGTTTCATT
GTTATAGAATTTTAAACCACGTTTCTGGCTTTGTTCTTGGTATTCAGTTGAAATTAGTAA
TAATTCAAGGAATAGTTTACTTATTTTCGCGGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved